Rh5BG492700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0003987
Physical Location & Seq
Reverse (-)
78502195 .. 78502925
731 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG492700.1

Sequence Viewer

Length: 273 bp
ATGGCGGTGCTCGATCCTCTCTCTCCTCTCTCCCTCTTCAGCCCCCTCACATCACTGAGTGCCTCGTTAGCGATGAGACTGGAACCATTGTCTTCACTGCTAACAATGACCAAGCCTAGTACCACTGTGATTCCACGCAATACAAAGATTGACATGTTCATCAAAGGCACTATGAGGCTTCAGTTGATAAATGGGGTAGTGTTGAAGTCACAGAACCAGCCAGCTTTGAAGTTAAGGAGGTCAACAATCTTTCTCTTGTCGAGTATGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.89

Weight (kDa)

11.48

Isoelectric Point (pI)

40.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AclWI GGATC 1 cut(s) 8
AcuI CTGAAG 2 cut(s) 22, 164
AdeI CACNNNGTG 1 cut(s) 59
AfaI GTAC 1 cut(s) 121
AflIII ACRYGT 1 cut(s) 153
AgsI TTSAA 2 cut(s) 205, 229
AluBI AGCT 1 cut(s) 224
AluI AGCT 1 cut(s) 224
Alw21I GWGCWC 1 cut(s) 12
Alw26I GTCTC 1 cut(s) 70
AlwI GGATC 1 cut(s) 8
BbsI GAAGAC 1 cut(s) 84
Bbv12I GWGCWC 1 cut(s) 12
BcoDI GTCTC 1 cut(s) 70
BfaI CTAG 1 cut(s) 117
BmiI GGNNCC 1 cut(s) 84
BpiI GAAGAC 1 cut(s) 84
Bse1I ACTGG 1 cut(s) 84
BseMII CTCAG 1 cut(s) 47
BseNI ACTGG 1 cut(s) 84
BseRI GAGGAG 1 cut(s) 15
BsiHKAI GWGCWC 1 cut(s) 12
BsmAI GTCTC 1 cut(s) 70
Bsp1286I GDGCHC 1 cut(s) 12
Bsp143I GATC 1 cut(s) 13
BspACI CCGC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 48
BspLI GGNNCC 1 cut(s) 84
BspPI GGATC 1 cut(s) 8
BsrI ACTGG 1 cut(s) 84
BssMI GATC 1 cut(s) 13
Bst4CI ACNGT 1 cut(s) 127
Bst6I CTCTTC 1 cut(s) 41
BstC8I GCNNGC 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 56
BstKTI GATC 1 cut(s) 16
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 1 cut(s) 13
BstMWI GCNNNNNNNGC 1 cut(s) 68
BstNSI RCATGY 1 cut(s) 157
BstV2I GAAGAC 1 cut(s) 84
BtgZI GCGATG 1 cut(s) 86
BtsI GCAGTG 1 cut(s) 95
BtsIMutI CAGTG 3 cut(s) 53, 95, 123
Cac8I GCNNGC 1 cut(s) 222
Csp6I GTAC 1 cut(s) 120
CviAII CATG 1 cut(s) 154
CviJI RGCY 5 cut(s) 42, 115, 178, 220, 224
CviKI_1 RGCY 5 cut(s) 42, 115, 178, 220, 224
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 1 cut(s) 56
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
DraIII CACNNNGTG 1 cut(s) 59
Eam1104I CTCTTC 1 cut(s) 41
EarI CTCTTC 1 cut(s) 41
Eco57I CTGAAG 2 cut(s) 22, 164
FaeI CATG 1 cut(s) 157
FaiI YATR 3 cut(s) 155, 173, 266
FatI CATG 1 cut(s) 153
FspBI CTAG 1 cut(s) 117
Hin1II CATG 1 cut(s) 157
HincII GTYRAC 1 cut(s) 243
HindII GTYRAC 1 cut(s) 243
HinfI GANTC 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 243
Hpy8I GTNNAC 1 cut(s) 243
HpyCH4III ACNGT 1 cut(s) 127
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 56
Hsp92II CATG 1 cut(s) 157
Kzo9I GATC 1 cut(s) 13
LpnPI CCDG 3 cut(s) 65, 230, 234
MaeI CTAG 1 cut(s) 117
MaeIII GTNAC 1 cut(s) 207
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MboII GAAGA 2 cut(s) 28, 84
MhlI GDGCHC 1 cut(s) 12
MluCI AATT 1 cut(s) 268
MnlI CCTC 7 cut(s) 27, 36, 44, 56, 73, 168, 231
MseI TTAA 2 cut(s) 233, 271
MwoI GCNNNNNNNGC 1 cut(s) 68
NdeII GATC 1 cut(s) 13
NlaIII CATG 1 cut(s) 157
NlaIV GGNNCC 1 cut(s) 84
NmuCI GTSAC 1 cut(s) 207
NspI RCATGY 1 cut(s) 157
PciI ACATGT 1 cut(s) 153
PfeI GAWTC 1 cut(s) 130
PscI ACATGT 1 cut(s) 153
PspN4I GGNNCC 1 cut(s) 84
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SaqAI TTAA 2 cut(s) 233, 271
Sau3AI GATC 1 cut(s) 13
SduI GDGCHC 1 cut(s) 12
SetI ASST 2 cut(s) 226, 242
Sse9I AATT 1 cut(s) 268
SsiI CCGC 1 cut(s) 5
SspMI CTAG 1 cut(s) 117
TaaI ACNGT 1 cut(s) 127
TaqI TCGA 2 cut(s) 12, 260
TasI AATT 1 cut(s) 268
TfiI GAWTC 1 cut(s) 130
Tru1I TTAA 2 cut(s) 233, 271
Tru9I TTAA 2 cut(s) 233, 271
TscAI CASTG 3 cut(s) 60, 102, 130
TseFI GTSAC 1 cut(s) 207
Tsp45I GTSAC 1 cut(s) 207
TspDTI ATGAA 1 cut(s) 148
TspRI CASTG 3 cut(s) 60, 102, 130
XceI RCATGY 1 cut(s) 157
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.