Rh3CG304000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0003987
Physical Location & Seq
Forward (+)
31617853 .. 31618658
806 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG304000.1

Sequence Viewer

Length: 249 bp
ATGAGACTGGAACCATTGTCTTCACTGCTCGCAATGACCAAGCCTAGTACCACTGTGATTCCACGCAATACAAAGATTGACATGTTCATCAAAGGCACTATGAGGCTTCTGTTGATAAATGGGGTCGTGTTGAAGTCACAGAACCAGCCAGCTTTGAAGTTAAGGAGGTCAACAATCTTTCTCTTGTCGAGTATGAATTACTTAGTGTTGCTGAATGAGATCAGAAAAGCTAATTTGATGAAAGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.34

Weight (kDa)

11.07

Isoelectric Point (pI)

29.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 49
AflIII ACRYGT 1 cut(s) 81
AgsI TTSAA 2 cut(s) 133, 157
AluBI AGCT 2 cut(s) 152, 230
AluI AGCT 2 cut(s) 152, 230
BbsI GAAGAC 1 cut(s) 12
BfaI CTAG 1 cut(s) 45
BmiI GGNNCC 1 cut(s) 12
BpiI GAAGAC 1 cut(s) 12
Bse1I ACTGG 1 cut(s) 12
Bse3DI GCAATG 1 cut(s) 39
BseMI GCAATG 1 cut(s) 39
BseNI ACTGG 1 cut(s) 12
Bsp143I GATC 1 cut(s) 219
BspLI GGNNCC 1 cut(s) 12
BsrDI GCAATG 1 cut(s) 39
BsrI ACTGG 1 cut(s) 12
BssMI GATC 1 cut(s) 219
Bst4CI ACNGT 1 cut(s) 55
BstC8I GCNNGC 2 cut(s) 30, 150
BstDEI CTNAG 1 cut(s) 202
BstKTI GATC 1 cut(s) 222
BstMBI GATC 1 cut(s) 219
BstNSI RCATGY 1 cut(s) 85
BstV2I GAAGAC 1 cut(s) 12
BtsI GCAGTG 1 cut(s) 23
BtsIMutI CAGTG 2 cut(s) 23, 51
Cac8I GCNNGC 2 cut(s) 30, 150
Csp6I GTAC 1 cut(s) 48
CviAII CATG 1 cut(s) 82
CviJI RGCY 5 cut(s) 43, 106, 148, 152, 230
CviKI_1 RGCY 5 cut(s) 43, 106, 148, 152, 230
CviQI GTAC 1 cut(s) 48
DdeI CTNAG 1 cut(s) 202
DpnI GATC 1 cut(s) 221
DpnII GATC 1 cut(s) 219
FaeI CATG 1 cut(s) 85
FaiI YATR 3 cut(s) 83, 101, 194
FatI CATG 1 cut(s) 81
FspBI CTAG 1 cut(s) 45
Hin1II CATG 1 cut(s) 85
HincII GTYRAC 1 cut(s) 171
HindII GTYRAC 1 cut(s) 171
HinfI GANTC 1 cut(s) 58
Hpy166II GTNNAC 1 cut(s) 171
Hpy188I TCNGA 1 cut(s) 224
Hpy8I GTNNAC 1 cut(s) 171
HpyCH4III ACNGT 1 cut(s) 55
HpyF3I CTNAG 1 cut(s) 202
Hsp92II CATG 1 cut(s) 85
Kzo9I GATC 1 cut(s) 219
LpnPI CCDG 2 cut(s) 158, 162
MaeI CTAG 1 cut(s) 45
MaeIII GTNAC 1 cut(s) 135
MalI GATC 1 cut(s) 221
MboI GATC 1 cut(s) 219
MboII GAAGA 1 cut(s) 12
MluCI AATT 2 cut(s) 196, 232
MnlI CCTC 2 cut(s) 96, 159
MseI TTAA 1 cut(s) 161
NdeII GATC 1 cut(s) 219
NlaIII CATG 1 cut(s) 85
NlaIV GGNNCC 1 cut(s) 12
NmuCI GTSAC 1 cut(s) 135
NspI RCATGY 1 cut(s) 85
PciI ACATGT 1 cut(s) 81
PfeI GAWTC 1 cut(s) 58
PscI ACATGT 1 cut(s) 81
PspN4I GGNNCC 1 cut(s) 12
RsaI GTAC 1 cut(s) 49
RsaNI GTAC 1 cut(s) 48
SaqAI TTAA 1 cut(s) 161
Sau3AI GATC 1 cut(s) 219
SetI ASST 3 cut(s) 154, 170, 232
Sse9I AATT 2 cut(s) 196, 232
SspMI CTAG 1 cut(s) 45
TaaI ACNGT 1 cut(s) 55
TaqI TCGA 1 cut(s) 188
TasI AATT 2 cut(s) 196, 232
TfiI GAWTC 1 cut(s) 58
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
TscAI CASTG 2 cut(s) 30, 58
TseFI GTSAC 1 cut(s) 135
Tsp45I GTSAC 1 cut(s) 135
TspDTI ATGAA 2 cut(s) 76, 209
TspRI CASTG 2 cut(s) 30, 58
XceI RCATGY 1 cut(s) 85
XspI CTAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.