Rh6DG030600

Belongs to the HisA HisF family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
2984053 .. 2984883
831 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG030600.1

Sequence Viewer

Length: 228 bp
ATGCAAAGATTGACATGTTCGATCAAGGGGACTATGAGGCTTGCAATTGATAAATGGGGTTGTGTTGAAGTCACAGAACCAGCCAGCTTTGAAGTCAAAGGAGGCCAACAATCTTTCTCTTGTCGAGTGAAAAGTGGAAAAAGTAGCTTAGAGCAGATACCTAGAGTTTACGGAAATCATGTTGTGGTTGTAAGCATTGATTCTTGCAGAGTGTACATCAAAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.34

Weight (kDa)

9.3

Isoelectric Point (pI)

24.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 215
AflIII ACRYGT 1 cut(s) 14
AgsI TTSAA 2 cut(s) 68, 92
AluBI AGCT 2 cut(s) 87, 147
AluI AGCT 2 cut(s) 87, 147
AoxI GGCC 1 cut(s) 103
BfaI CTAG 1 cut(s) 162
BshFI GGCC 1 cut(s) 105
BslFI GGGAC 1 cut(s) 43
BsmFI GGGAC 1 cut(s) 43
BsnI GGCC 1 cut(s) 105
Bsp1407I TGTACA 1 cut(s) 213
Bsp143I GATC 1 cut(s) 21
BspANI GGCC 1 cut(s) 105
BsrGI TGTACA 1 cut(s) 213
BssMI GATC 1 cut(s) 21
BstAUI TGTACA 1 cut(s) 213
BstC8I GCNNGC 2 cut(s) 42, 85
BstDEI CTNAG 1 cut(s) 148
BstKTI GATC 1 cut(s) 24
BstMBI GATC 1 cut(s) 21
BstNSI RCATGY 1 cut(s) 18
BsuRI GGCC 1 cut(s) 105
Cac8I GCNNGC 2 cut(s) 42, 85
Csp6I GTAC 1 cut(s) 214
CviAII CATG 2 cut(s) 15, 179
CviJI RGCY 5 cut(s) 40, 83, 87, 105, 147
CviKI_1 RGCY 5 cut(s) 40, 83, 87, 105, 147
CviQI GTAC 1 cut(s) 214
DdeI CTNAG 1 cut(s) 148
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
FaeI CATG 2 cut(s) 18, 182
FaiI YATR 3 cut(s) 16, 35, 180
FaqI GGGAC 1 cut(s) 43
FatI CATG 2 cut(s) 14, 178
FspBI CTAG 1 cut(s) 162
HaeIII GGCC 1 cut(s) 105
Hin1II CATG 2 cut(s) 18, 182
HinfI GANTC 1 cut(s) 200
Hpy166II GTNNAC 2 cut(s) 169, 214
Hpy8I GTNNAC 2 cut(s) 169, 214
HpyCH4V TGCA 3 cut(s) 4, 44, 207
HpyF3I CTNAG 1 cut(s) 148
Hsp92II CATG 2 cut(s) 18, 182
Kzo9I GATC 1 cut(s) 21
LpnPI CCDG 2 cut(s) 93, 97
MaeI CTAG 1 cut(s) 162
MaeIII GTNAC 1 cut(s) 70
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MfeI CAATTG 1 cut(s) 45
MluCI AATT 2 cut(s) 45, 223
MnlI CCTC 2 cut(s) 30, 95
MseI TTAA 1 cut(s) 226
MunI CAATTG 1 cut(s) 45
NdeII GATC 1 cut(s) 21
NlaIII CATG 2 cut(s) 18, 182
NmuCI GTSAC 1 cut(s) 70
NspI RCATGY 1 cut(s) 18
PciI ACATGT 1 cut(s) 14
PfeI GAWTC 1 cut(s) 200
PscI ACATGT 1 cut(s) 14
RsaI GTAC 1 cut(s) 215
RsaNI GTAC 1 cut(s) 214
SaqAI TTAA 1 cut(s) 226
Sau3AI GATC 1 cut(s) 21
SetI ASST 3 cut(s) 89, 149, 163
Sse9I AATT 2 cut(s) 45, 223
SspMI CTAG 1 cut(s) 162
TaqI TCGA 2 cut(s) 20, 124
TasI AATT 2 cut(s) 45, 223
TatI WGTACW 1 cut(s) 213
TfiI GAWTC 1 cut(s) 200
Tru1I TTAA 1 cut(s) 226
Tru9I TTAA 1 cut(s) 226
TseFI GTSAC 1 cut(s) 70
Tsp45I GTSAC 1 cut(s) 70
TspGWI ACGGA 1 cut(s) 186
XceI RCATGY 1 cut(s) 18
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.