Rh2CG232200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0001454
Physical Location & Seq
Reverse (-)
23600199 .. 23604745
4547 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG232200.1

Sequence Viewer

Length: 243 bp
ATGTTCCTAAAAGAGGTGACCATCAAAGAGAGACTTCAGCGCGCATGGTCGTATAGTTCAACATGTAGTGGCGTAGCGACGACAAATCACGTGGGCGGGAAGGTCGGAATCACTGACCAAACCAGACGTGGGTTTGGAGAGATGCCCACTAATAACTATGTCAAGAACAGGTACTTACAACTTTTGAAGACTTGGGGATATGGGTGGATGTCTTTGCTACTAGTGAAGTCAGTATTTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.12

Weight (kDa)

10.01

Isoelectric Point (pI)

22.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 42
AciI CCGC 1 cut(s) 96
AcuI CTGAAG 1 cut(s) 20
AcvI CACGTG 1 cut(s) 91
AfaI GTAC 1 cut(s) 173
AfiI CCNNNNNNNGG 2 cut(s) 13, 129
AflIII ACRYGT 1 cut(s) 62
AgsI TTSAA 2 cut(s) 60, 187
AhlI ACTAGT 1 cut(s) 220
AjiI CACGTC 1 cut(s) 128
Alw26I GTCTC 1 cut(s) 25
AspLEI GCGC 2 cut(s) 42, 44
AsuHPI GGTGA 1 cut(s) 28
BbrPI CACGTG 1 cut(s) 91
BbsI GAAGAC 1 cut(s) 194
BccI CCATC 1 cut(s) 29
BcoDI GTCTC 1 cut(s) 25
BcuI ACTAGT 1 cut(s) 220
BfaI CTAG 1 cut(s) 221
BmgBI CACGTC 1 cut(s) 128
BmsI GCATC 1 cut(s) 132
BpiI GAAGAC 1 cut(s) 194
BsaAI YACGTR 1 cut(s) 91
Bsc4I CCNNNNNNNGG 2 cut(s) 13, 129
BseGI GGATG 1 cut(s) 213
BseLI CCNNNNNNNGG 2 cut(s) 13, 129
BsePI GCGCGC 1 cut(s) 40
Bsh1236I CGCG 1 cut(s) 42
BslI CCNNNNNNNGG 2 cut(s) 13, 129
BsmAI GTCTC 1 cut(s) 25
BspACI CCGC 1 cut(s) 96
BspFNI CGCG 1 cut(s) 42
BssHII GCGCGC 1 cut(s) 40
BstBAI YACGTR 1 cut(s) 91
BstC8I GCNNGC 1 cut(s) 42
BstEII GGTNACC 1 cut(s) 16
BstENI CCTNNNNNAGG 1 cut(s) 11
BstF5I GGATG 1 cut(s) 213
BstFNI CGCG 1 cut(s) 42
BstHHI GCGC 2 cut(s) 42, 44
BstMAI GTCTC 1 cut(s) 25
BstNSI RCATGY 1 cut(s) 66
BstPI GGTNACC 1 cut(s) 16
BstUI CGCG 1 cut(s) 42
BstV2I GAAGAC 1 cut(s) 194
BtrI CACGTC 1 cut(s) 128
BtsCI GGATG 1 cut(s) 213
BtsIMutI CAGTG 1 cut(s) 111
Cac8I GCNNGC 1 cut(s) 42
CfoI GCGC 2 cut(s) 42, 44
Csp6I GTAC 1 cut(s) 172
CspCI CAANNNNNGTGG 2 cut(s) 72, 107
CviAII CATG 2 cut(s) 45, 63
CviQI GTAC 1 cut(s) 172
Eco57I CTGAAG 1 cut(s) 20
Eco72I CACGTG 1 cut(s) 91
Eco91I GGTNACC 1 cut(s) 16
EcoNI CCTNNNNNAGG 1 cut(s) 11
EcoO65I GGTNACC 1 cut(s) 16
FaeI CATG 2 cut(s) 48, 66
FaiI YATR 5 cut(s) 46, 54, 64, 159, 201
FalI AAGNNNNNCTT 2 cut(s) 18, 50
FatI CATG 2 cut(s) 44, 62
FauI CCCGC 1 cut(s) 89
FokI GGATG 1 cut(s) 220
FspBI CTAG 1 cut(s) 221
GlaI GCGC 2 cut(s) 41, 43
HhaI GCGC 2 cut(s) 42, 44
Hin1II CATG 2 cut(s) 48, 66
Hin6I GCGC 2 cut(s) 40, 42
HinP1I GCGC 2 cut(s) 40, 42
HinfI GANTC 1 cut(s) 108
HphI GGTGA 1 cut(s) 28
Hpy188I TCNGA 1 cut(s) 107
Hpy188III TCNNGA 1 cut(s) 163
Hpy99I CGWCG 1 cut(s) 82
HpyAV CCTTC 1 cut(s) 94
HpyCH4IV ACGT 2 cut(s) 90, 127
HpySE526I ACGT 2 cut(s) 90, 127
Hsp92II CATG 2 cut(s) 48, 66
HspAI GCGC 2 cut(s) 40, 42
LpnPI CCDG 2 cut(s) 136, 154
LweI GCATC 1 cut(s) 132
MaeI CTAG 1 cut(s) 221
MaeII ACGT 2 cut(s) 90, 127
MaeIII GTNAC 1 cut(s) 16
MboII GAAGA 1 cut(s) 199
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 1 cut(s) 7
MvnI CGCG 1 cut(s) 42
NlaIII CATG 2 cut(s) 48, 66
NmuCI GTSAC 1 cut(s) 16
NspI RCATGY 1 cut(s) 66
PauI GCGCGC 1 cut(s) 40
PciI ACATGT 1 cut(s) 62
PfeI GAWTC 1 cut(s) 108
PmaCI CACGTG 1 cut(s) 91
PmlI CACGTG 1 cut(s) 91
Ppu21I YACGTR 1 cut(s) 91
PscI ACATGT 1 cut(s) 62
PspCI CACGTG 1 cut(s) 91
PspEI GGTNACC 1 cut(s) 16
PteI GCGCGC 1 cut(s) 40
RsaI GTAC 1 cut(s) 173
RsaNI GTAC 1 cut(s) 172
SetI ASST 5 cut(s) 18, 93, 105, 130, 173
SfaNI GCATC 1 cut(s) 132
SpeI ACTAGT 1 cut(s) 220
SsiI CCGC 1 cut(s) 96
SspMI CTAG 1 cut(s) 221
TaiI ACGT 2 cut(s) 93, 130
TfiI GAWTC 1 cut(s) 108
TscAI CASTG 1 cut(s) 118
TseFI GTSAC 1 cut(s) 16
Tsp45I GTSAC 1 cut(s) 16
TspRI CASTG 1 cut(s) 118
XagI CCTNNNNNAGG 1 cut(s) 11
XceI RCATGY 1 cut(s) 66
XcmI CCANNNNNNNNNTGG 1 cut(s) 125
XspI CTAG 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.