Rh2CG337000

Auxilin-like protein 1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
44593686 .. 44610794
17109 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG337000.1

Sequence Viewer

Length: 294 bp
ATGCTCGAAGTCCCCGTCGCCGCCGCAGACGACGACAATGAGGAGTTCTTCGATGTGTGCGGCTTCGGCTTCAACTGCTCTGAGGTCTTCGGAGGCTTCGAAGGCCTGGATTTTGCCGTCGCATACGACGACCTAGTCAAGCAACCCTACGGCGGAGATGGTGGTTCCTCTGAAGAAGCTTGGACTCTCAGCAGAATCTGGGTCTCTCTCAGGAGAATCGAATCATTCTTTGTAATGGCAAATCTGCCGTCTTTCTTTTTTGGTTACACAAATCTGCCATCTTTCATTTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.84

Weight (kDa)

4.05

Isoelectric Point (pI)

55.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 134
AciI CCGC 4 cut(s) 21, 24, 60, 153
AcuI CTGAAG 1 cut(s) 192
AfiI CCNNNNNNNGG 1 cut(s) 152
AgsI TTSAA 1 cut(s) 73
AjnI CCWGG 1 cut(s) 105
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
Alw26I GTCTC 1 cut(s) 208
AlwNI CAGNNNCTG 1 cut(s) 198
AoxI GGCC 1 cut(s) 103
ArsI GACNNNNNNTTYG 3 cut(s) 32, 233, 265
AsuII TTCGAA 1 cut(s) 99
BbsI GAAGAC 1 cut(s) 79
BccI CCATC 2 cut(s) 152, 286
BceAI ACGGC 3 cut(s) 101, 166, 232
BciT130I CCWGG 1 cut(s) 107
BcoDI GTCTC 1 cut(s) 208
BfaI CTAG 1 cut(s) 134
BisI GCNGC 3 cut(s) 21, 24, 61
BlsI GCNGC 3 cut(s) 22, 25, 62
Bme1390I CCNGG 1 cut(s) 107
BmiI GGNNCC 1 cut(s) 166
BmrFI CCNGG 1 cut(s) 107
BpiI GAAGAC 1 cut(s) 79
Bpu14I TTCGAA 1 cut(s) 99
BsaI GGTCTC 1 cut(s) 208
Bsc4I CCNNNNNNNGG 1 cut(s) 152
BseBI CCWGG 1 cut(s) 107
BseLI CCNNNNNNNGG 1 cut(s) 152
BseMII CTCAG 3 cut(s) 72, 202, 223
BseRI GAGGAG 1 cut(s) 56
BshFI GGCC 1 cut(s) 105
BslI CCNNNNNNNGG 1 cut(s) 152
BsmAI GTCTC 1 cut(s) 208
BsnI GGCC 1 cut(s) 105
Bso31I GGTCTC 1 cut(s) 208
Bsp119I TTCGAA 1 cut(s) 99
BspACI CCGC 4 cut(s) 21, 24, 60, 153
BspANI GGCC 1 cut(s) 105
BspCNI CTCAG 3 cut(s) 73, 201, 222
BspLI GGNNCC 1 cut(s) 166
BspT104I TTCGAA 1 cut(s) 99
BspTNI GGTCTC 1 cut(s) 208
Bst2UI CCWGG 1 cut(s) 107
BstBI TTCGAA 1 cut(s) 99
BstDEI CTNAG 3 cut(s) 81, 188, 209
BstMAI GTCTC 1 cut(s) 208
BstMWI GCNNNNNNNGC 3 cut(s) 66, 75, 102
BstNI CCWGG 1 cut(s) 107
BstSCI CCNGG 1 cut(s) 105
BstV2I GAAGAC 1 cut(s) 79
BsuRI GGCC 1 cut(s) 105
CaiI CAGNNNCTG 1 cut(s) 198
CviJI RGCY 5 cut(s) 63, 69, 96, 105, 179
CviKI_1 RGCY 5 cut(s) 63, 69, 96, 105, 179
DdeI CTNAG 3 cut(s) 81, 188, 209
DrdI GACNNNNNNGTC 1 cut(s) 134
DseDI GACNNNNNNGTC 1 cut(s) 134
EciI GGCGGA 1 cut(s) 168
Eco147I AGGCCT 1 cut(s) 105
Eco31I GGTCTC 1 cut(s) 208
Eco57I CTGAAG 1 cut(s) 192
EcoRII CCWGG 1 cut(s) 105
FaiI YATR 1 cut(s) 124
Fnu4HI GCNGC 3 cut(s) 21, 24, 61
Fsp4HI GCNGC 3 cut(s) 21, 24, 61
FspBI CTAG 1 cut(s) 134
GluI GCNGC 3 cut(s) 21, 24, 61
HaeIII GGCC 1 cut(s) 105
HindIII AAGCTT 1 cut(s) 177
HinfI GANTC 4 cut(s) 184, 195, 216, 221
Hpy188I TCNGA 3 cut(s) 82, 92, 172
Hpy188III TCNNGA 1 cut(s) 211
Hpy99I CGWCG 4 cut(s) 20, 35, 122, 131
HpyAV CCTTC 1 cut(s) 95
HpyF10VI GCNNNNNNNGC 3 cut(s) 66, 75, 102
HpyF3I CTNAG 3 cut(s) 81, 188, 209
LpnPI CCDG 4 cut(s) 92, 119, 184, 196
MaeI CTAG 1 cut(s) 134
MaeIII GTNAC 1 cut(s) 263
MboII GAAGA 3 cut(s) 40, 79, 185
MlyI GAGTC 1 cut(s) 178
MnlI CCTC 4 cut(s) 34, 76, 86, 178
MspR9I CCNGG 1 cut(s) 107
MvaI CCWGG 1 cut(s) 107
MwoI GCNNNNNNNGC 3 cut(s) 66, 75, 102
NlaIV GGNNCC 1 cut(s) 166
NspV TTCGAA 1 cut(s) 99
PceI AGGCCT 1 cut(s) 105
PcsI WCGNNNNNNNCGW 3 cut(s) 12, 96, 126
PfeI GAWTC 3 cut(s) 195, 216, 221
PflFI GACNNNGTC 1 cut(s) 134
PkrI GCNGC 3 cut(s) 22, 25, 62
PleI GAGTC 1 cut(s) 178
PpsI GAGTC 1 cut(s) 178
Psp6I CCWGG 1 cut(s) 105
PspGI CCWGG 1 cut(s) 105
PspN4I GGNNCC 1 cut(s) 166
PstNI CAGNNNCTG 1 cut(s) 198
PsyI GACNNNGTC 1 cut(s) 134
SatI GCNGC 3 cut(s) 21, 24, 61
SchI GAGTC 1 cut(s) 178
ScrFI CCNGG 1 cut(s) 107
SetI ASST 3 cut(s) 87, 135, 181
SfuI TTCGAA 1 cut(s) 99
SgeI CNNG 9 cut(s) 17, 26, 118, 119, 146, 151, 192, 211, 223
SseBI AGGCCT 1 cut(s) 105
SsiI CCGC 4 cut(s) 21, 24, 60, 153
SspMI CTAG 1 cut(s) 134
StuI AGGCCT 1 cut(s) 105
StyD4I CCNGG 1 cut(s) 105
TaqI TCGA 4 cut(s) 6, 51, 99, 219
TauI GCSGC 3 cut(s) 23, 26, 63
TfiI GAWTC 3 cut(s) 195, 216, 221
TspDTI ATGAA 1 cut(s) 274
Tth111I GACNNNGTC 1 cut(s) 134
XspI CTAG 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.