Rh5BG424800

Auxilin-like protein 1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
68682233 .. 68682418
186 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG424800.1

Sequence Viewer

Length: 186 bp
ATGCTTCGCGCCTCCTTGATTCCAGTGCTAAAGGTCCCCGTCGCAGACGCAGTCGATGAAGATGACAATGAGGAATTCTTCAATGTGCGCTGCTTCGGCTTCGACTACTCGGAGGTCTTTGGAGGCTTCAATTGCCTGGATTTCGTCGTCGCGTACGACAACCTAGTCAAGCAACCCTACGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.9

Weight (kDa)

4.05

Isoelectric Point (pI)

41.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 164
AccII CGCG 2 cut(s) 9, 152
AcsI RAATTY 1 cut(s) 74
AfaI GTAC 1 cut(s) 155
AgsI TTSAA 2 cut(s) 82, 130
AjnI CCWGG 1 cut(s) 135
ApeKI GCWGC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 74
AspLEI GCGC 2 cut(s) 11, 90
AspS9I GGNCC 1 cut(s) 34
AvaII GGWCC 1 cut(s) 34
BbvI GCAGC 1 cut(s) 77
BciT130I CCWGG 1 cut(s) 137
BfaI CTAG 1 cut(s) 164
BisI GCNGC 1 cut(s) 91
BlsI GCNGC 1 cut(s) 92
Bme1390I CCNGG 1 cut(s) 137
Bme18I GGWCC 1 cut(s) 34
BmgT120I GGNCC 1 cut(s) 34
BmiI GGNNCC 1 cut(s) 36
BmrFI CCNGG 1 cut(s) 137
Bse1I ACTGG 1 cut(s) 23
BseBI CCWGG 1 cut(s) 137
BseNI ACTGG 1 cut(s) 23
BseXI GCAGC 1 cut(s) 77
Bsh1236I CGCG 2 cut(s) 9, 152
BsiWI CGTACG 1 cut(s) 153
BslFI GGGAC 1 cut(s) 20
BsmFI GGGAC 1 cut(s) 20
BspFNI CGCG 2 cut(s) 9, 152
BspLI GGNNCC 1 cut(s) 36
BsrI ACTGG 1 cut(s) 23
Bst2UI CCWGG 1 cut(s) 137
BstFNI CGCG 2 cut(s) 9, 152
BstHHI GCGC 2 cut(s) 11, 90
BstMWI GCNNNNNNNGC 2 cut(s) 96, 132
BstNI CCWGG 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 135
BstUI CGCG 2 cut(s) 9, 152
BstV1I GCAGC 1 cut(s) 77
BtsIMutI CAGTG 1 cut(s) 30
CfoI GCGC 2 cut(s) 11, 90
Cfr13I GGNCC 1 cut(s) 34
CseI GACGC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 154
CviJI RGCY 3 cut(s) 99, 126, 183
CviKI_1 RGCY 3 cut(s) 99, 126, 183
CviQI GTAC 1 cut(s) 154
DrdI GACNNNNNNGTC 1 cut(s) 164
DseDI GACNNNNNNGTC 1 cut(s) 164
Eco47I GGWCC 1 cut(s) 34
EcoO109I RGGNCCY 1 cut(s) 34
EcoRI GAATTC 1 cut(s) 74
EcoRII CCWGG 1 cut(s) 135
FaqI GGGAC 1 cut(s) 20
Fnu4HI GCNGC 1 cut(s) 91
Fsp4HI GCNGC 1 cut(s) 91
FspBI CTAG 1 cut(s) 164
GlaI GCGC 2 cut(s) 10, 89
GluI GCNGC 1 cut(s) 91
HgaI GACGC 1 cut(s) 56
HhaI GCGC 2 cut(s) 11, 90
Hin6I GCGC 2 cut(s) 9, 88
HinP1I GCGC 2 cut(s) 9, 88
HinfI GANTC 1 cut(s) 19
Hpy188I TCNGA 1 cut(s) 112
Hpy99I CGWCG 3 cut(s) 44, 149, 152
HpyF10VI GCNNNNNNNGC 2 cut(s) 96, 132
HspAI GCGC 2 cut(s) 9, 88
LpnPI CCDG 3 cut(s) 36, 122, 149
Lsp1109I GCAGC 1 cut(s) 77
MaeI CTAG 1 cut(s) 164
MboII GAAGA 2 cut(s) 70, 71
MfeI CAATTG 1 cut(s) 130
MluCI AATT 2 cut(s) 74, 130
MnlI CCTC 4 cut(s) 22, 64, 106, 116
MspR9I CCNGG 1 cut(s) 137
MunI CAATTG 1 cut(s) 130
MvaI CCWGG 1 cut(s) 137
MvnI CGCG 2 cut(s) 9, 152
MwoI GCNNNNNNNGC 2 cut(s) 96, 132
NlaIV GGNNCC 1 cut(s) 36
PcsI WCGNNNNNNNCGW 1 cut(s) 153
PfeI GAWTC 1 cut(s) 19
Pfl23II CGTACG 1 cut(s) 153
PflFI GACNNNGTC 1 cut(s) 50
PkrI GCNGC 1 cut(s) 92
PpuMI RGGWCCY 1 cut(s) 34
Psp5II RGGWCCY 1 cut(s) 34
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PspLI CGTACG 1 cut(s) 153
PspN4I GGNNCC 1 cut(s) 36
PspPI GGNCC 1 cut(s) 34
PspPPI RGGWCCY 1 cut(s) 34
PsyI GACNNNGTC 1 cut(s) 50
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
SatI GCNGC 1 cut(s) 91
Sau96I GGNCC 1 cut(s) 34
ScrFI CCNGG 1 cut(s) 137
SetI ASST 3 cut(s) 36, 117, 165
SinI GGWCC 1 cut(s) 34
Sse9I AATT 2 cut(s) 74, 130
SspMI CTAG 1 cut(s) 164
StyD4I CCNGG 1 cut(s) 135
TaqI TCGA 2 cut(s) 54, 102
TasI AATT 2 cut(s) 74, 130
TfiI GAWTC 1 cut(s) 19
TscAI CASTG 1 cut(s) 30
TseI GCWGC 1 cut(s) 90
TspDTI ATGAA 1 cut(s) 72
TspRI CASTG 1 cut(s) 30
Tth111I GACNNNGTC 1 cut(s) 50
VpaK11BI GGWCC 1 cut(s) 34
XapI RAATTY 1 cut(s) 74
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.