Rh2DG487500

Proton-conducting pore forming subunit of the membrane integral V0 complex of vacuolar ATPase. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
70368851 .. 70369123
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG487500.1

Sequence Viewer

Length: 273 bp
ATGGGCGCGGCATACTGGTTCGCCAAGAGTGGCGTGGGCGTGGCCTCGATGGGAGTGATGCCGCAGGAGCTGGTCATGAAATCGATTGTTCCGGTGGTCATAGCTAGAGTGCTTGGGATCTACGGCCTCAACATAGCTGTGATTATCAGCATCGGGATCAATCCAAAGGCTAAATCTTATTACCTGTTTGATGGATATGCTCACTTGTCCTATGTCCTTACTTGTGGCCTCGCTGGACTTTCCACCGTCGTCATCCCCCCTTCCCTCCTCTGA

Protein Analysis

90

Amino Acids

9.45

Weight (kDa)

9.21

Isoelectric Point (pI)

28.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_C PF00137 1 - 49 3.8e-07 ATP synthase subunit C
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 8
AciI CCGC 2 cut(s) 8, 62
AclWI GGATC 2 cut(s) 125, 164
AluBI AGCT 3 cut(s) 70, 104, 137
AluI AGCT 3 cut(s) 70, 104, 137
AlwI GGATC 2 cut(s) 125, 164
AlwNI CAGNNNCTG 1 cut(s) 70
AoxI GGCC 3 cut(s) 42, 124, 226
AspLEI GCGC 1 cut(s) 8
BccI CCATC 2 cut(s) 43, 185
BceAI ACGGC 1 cut(s) 139
BfaI CTAG 1 cut(s) 105
BisI GCNGC 2 cut(s) 9, 62
BlsI GCNGC 2 cut(s) 10, 63
BmsI GCATC 2 cut(s) 48, 159
Bsa29I ATCGAT 1 cut(s) 83
BsaWI WCCGGW 1 cut(s) 91
Bse1I ACTGG 1 cut(s) 20
BseCI ATCGAT 1 cut(s) 83
BseGI GGATG 1 cut(s) 252
BseNI ACTGG 1 cut(s) 20
BseRI GAGGAG 1 cut(s) 257
Bsh1236I CGCG 1 cut(s) 8
BshFI GGCC 3 cut(s) 44, 126, 228
BshVI ATCGAT 1 cut(s) 83
BsiSI CCGG 1 cut(s) 92
BsnI GGCC 3 cut(s) 44, 126, 228
Bsp143I GATC 2 cut(s) 117, 156
BspACI CCGC 2 cut(s) 8, 62
BspANI GGCC 3 cut(s) 44, 126, 228
BspDI ATCGAT 1 cut(s) 83
BspFNI CGCG 1 cut(s) 8
BspHI TCATGA 1 cut(s) 75
BspPI GGATC 2 cut(s) 125, 164
BsrI ACTGG 1 cut(s) 20
BssMI GATC 2 cut(s) 117, 156
Bst4CI ACNGT 1 cut(s) 247
BstF5I GGATG 1 cut(s) 252
BstFNI CGCG 1 cut(s) 8
BstHHI GCGC 1 cut(s) 8
BstKTI GATC 2 cut(s) 120, 159
BstMBI GATC 2 cut(s) 117, 156
BstMWI GCNNNNNNNGC 1 cut(s) 67
BstUI CGCG 1 cut(s) 8
BstX2I RGATCY 1 cut(s) 117
BstYI RGATCY 1 cut(s) 117
Bsu15I ATCGAT 1 cut(s) 83
BsuRI GGCC 3 cut(s) 44, 126, 228
BsuTUI ATCGAT 1 cut(s) 83
BtsCI GGATG 1 cut(s) 252
CaiI CAGNNNCTG 1 cut(s) 70
CciI TCATGA 1 cut(s) 75
CfoI GCGC 1 cut(s) 8
ClaI ATCGAT 1 cut(s) 83
CviAII CATG 1 cut(s) 76
CviJI RGCY 7 cut(s) 44, 70, 104, 126, 137, 170, 228
CviKI_1 RGCY 7 cut(s) 44, 70, 104, 126, 137, 170, 228
DpnI GATC 2 cut(s) 119, 158
DpnII GATC 2 cut(s) 117, 156
FaeI CATG 1 cut(s) 79
FaiI YATR 6 cut(s) 13, 77, 101, 134, 198, 213
FatI CATG 1 cut(s) 75
Fnu4HI GCNGC 2 cut(s) 9, 62
FokI GGATG 1 cut(s) 239
Fsp4HI GCNGC 2 cut(s) 9, 62
FspBI CTAG 1 cut(s) 105
GlaI GCGC 1 cut(s) 7
GluI GCNGC 2 cut(s) 9, 62
HaeIII GGCC 3 cut(s) 44, 126, 228
HapII CCGG 1 cut(s) 92
HhaI GCGC 1 cut(s) 8
Hin1II CATG 1 cut(s) 79
Hin6I GCGC 1 cut(s) 6
HinP1I GCGC 1 cut(s) 6
HpaII CCGG 1 cut(s) 92
Hpy188I TCNGA 1 cut(s) 272
Hpy188III TCNNGA 2 cut(s) 76, 154
Hpy99I CGWCG 1 cut(s) 251
HpyAV CCTTC 1 cut(s) 270
HpyCH4III ACNGT 1 cut(s) 247
HpyF10VI GCNNNNNNNGC 1 cut(s) 67
Hsp92II CATG 1 cut(s) 79
HspAI GCGC 1 cut(s) 6
Kzo9I GATC 2 cut(s) 117, 156
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 5 cut(s) 50, 56, 105, 197, 219
LweI GCATC 2 cut(s) 48, 159
MaeI CTAG 1 cut(s) 105
MalI GATC 2 cut(s) 119, 158
MboI GATC 2 cut(s) 117, 156
MflI RGATCY 1 cut(s) 117
MnlI CCTC 3 cut(s) 55, 137, 239
MslI CAYNNNNRTG 1 cut(s) 137
MspI CCGG 1 cut(s) 92
MvnI CGCG 1 cut(s) 8
MwoI GCNNNNNNNGC 1 cut(s) 67
NdeII GATC 2 cut(s) 117, 156
NlaIII CATG 1 cut(s) 79
PagI TCATGA 1 cut(s) 75
PkrI GCNGC 2 cut(s) 10, 63
PstNI CAGNNNCTG 1 cut(s) 70
PsuI RGATCY 1 cut(s) 117
RseI CAYNNNNRTG 1 cut(s) 137
SatI GCNGC 2 cut(s) 9, 62
Sau3AI GATC 2 cut(s) 117, 156
SetI ASST 4 cut(s) 72, 106, 139, 186
SfaNI GCATC 2 cut(s) 48, 159
SmiMI CAYNNNNRTG 1 cut(s) 137
SsiI CCGC 2 cut(s) 8, 62
SspMI CTAG 1 cut(s) 105
TaaI ACNGT 1 cut(s) 247
TaqI TCGA 2 cut(s) 47, 83
TauI GCSGC 2 cut(s) 11, 64
TspDTI ATGAA 1 cut(s) 92
XcmI CCANNNNNNNNNTGG 1 cut(s) 31
XspI CTAG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.