Rh3DG063200

SPT2 chromatin protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0004232
Physical Location & Seq
Reverse (-)
4204720 .. 4204929
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG063200.1

Sequence Viewer

Length: 210 bp
ATGGGGAGAAGAGGAAAGCGGCGATACAGGGATTATGGTGACGACGGCGATGATCGTGCTATGGTGTCTGGCTTTAATGATATTCTGAAAGAAGAGAGGAGGAGTGCAGAGATTGCGAGGAAGGAGGATGCAATAGAGGCTCTAAGGCTTGAGCAAGAAGCCAAAGAAGAGAGGTTGACTAAAGCAAAGAAGCAGAAGTTGAAGAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SPT2

Protein Analysis

69

Amino Acids

8.14

Weight (kDa)

9.57

Isoelectric Point (pI)

69.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SPT2 PF08243 3 - 61 1.4e-11 SPT2 chromatin protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 19
AgsI TTSAA 1 cut(s) 202
AsuHPI GGTGA 1 cut(s) 50
BceAI ACGGC 1 cut(s) 61
BcgI CGANNNNNNTGC 2 cut(s) 38, 72
BisI GCNGC 1 cut(s) 20
BlsI GCNGC 1 cut(s) 21
BmsI GCATC 1 cut(s) 118
BpuEI CTTGAG 1 cut(s) 170
BseGI GGATG 1 cut(s) 133
BseRI GAGGAG 2 cut(s) 112, 115
BsgI GTGCAG 1 cut(s) 126
Bsp143I GATC 1 cut(s) 52
BspACI CCGC 1 cut(s) 19
BssMI GATC 1 cut(s) 52
Bst6I CTCTTC 3 cut(s) 4, 87, 162
BstAPI GCANNNNNTGC 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 143
BstF5I GGATG 1 cut(s) 133
BstKTI GATC 1 cut(s) 55
BstMBI GATC 1 cut(s) 52
BstMWI GCNNNNNNNGC 2 cut(s) 113, 137
BtgZI GCGATG 1 cut(s) 63
BtsCI GGATG 1 cut(s) 133
CviJI RGCY 4 cut(s) 72, 140, 148, 161
CviKI_1 RGCY 4 cut(s) 72, 140, 148, 161
DdeI CTNAG 1 cut(s) 143
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
Eam1104I CTCTTC 3 cut(s) 4, 87, 162
EarI CTCTTC 3 cut(s) 4, 87, 162
FaiI YATR 2 cut(s) 36, 62
Fnu4HI GCNGC 1 cut(s) 20
FokI GGATG 1 cut(s) 140
Fsp4HI GCNGC 1 cut(s) 20
GluI GCNGC 1 cut(s) 20
HincII GTYRAC 1 cut(s) 177
HindII GTYRAC 1 cut(s) 177
HphI GGTGA 1 cut(s) 50
Hpy166II GTNNAC 1 cut(s) 177
Hpy188I TCNGA 1 cut(s) 87
Hpy8I GTNNAC 1 cut(s) 177
Hpy99I CGWCG 1 cut(s) 47
HpyAV CCTTC 1 cut(s) 115
HpyCH4V TGCA 2 cut(s) 107, 131
HpyF10VI GCNNNNNNNGC 2 cut(s) 113, 137
HpyF3I CTNAG 1 cut(s) 143
Kzo9I GATC 1 cut(s) 52
LpnPI CCDG 2 cut(s) 13, 54
LweI GCATC 1 cut(s) 118
MaeIII GTNAC 1 cut(s) 38
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 3 cut(s) 21, 104, 179
MluCI AATT 1 cut(s) 205
MnlI CCTC 7 cut(s) 5, 90, 93, 111, 118, 130, 165
MseI TTAA 1 cut(s) 75
MwoI GCNNNNNNNGC 2 cut(s) 113, 137
NdeII GATC 1 cut(s) 52
NmuCI GTSAC 1 cut(s) 38
PkrI GCNGC 1 cut(s) 21
SaqAI TTAA 1 cut(s) 75
SatI GCNGC 1 cut(s) 20
Sau3AI GATC 1 cut(s) 52
SetI ASST 1 cut(s) 176
SfaNI GCATC 1 cut(s) 118
SgeI CNNG 6 cut(s) 40, 68, 81, 129, 161, 167
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
Sse9I AATT 1 cut(s) 205
SsiI CCGC 1 cut(s) 19
TasI AATT 1 cut(s) 205
TauI GCSGC 1 cut(s) 22
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TseFI GTSAC 1 cut(s) 38
Tsp45I GTSAC 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.