Rh5AG327600

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
49499054 .. 49512059
13006 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG327600.1

Sequence Viewer

Length: 192 bp
ATGGATGAAAATAAAATGAGTGCTACAAGAATGCAAGCTGACAACGAAGAATTGGAGTTGAAGCATGAGAGATATGGTTGCTGCCAAAAAGAATGTTGGGTTGTTGTTTTGCCATGTGGTTCCCGCAAACCTACCAAGTCTTACAAGTTGGAGCTTGCAATATATTCTAGTATGCAGAAACTGCAAGTTTGA

Protein Analysis

63

Amino Acids

7.36

Weight (kDa)

7.64

Isoelectric Point (pI)

39.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 124
AgsI TTSAA 1 cut(s) 61
AluBI AGCT 2 cut(s) 38, 154
AluI AGCT 2 cut(s) 38, 154
AlwNI CAGNNNCTG 1 cut(s) 181
ApeKI GCWGC 1 cut(s) 81
BbvI GCAGC 1 cut(s) 68
BfaI CTAG 1 cut(s) 168
BisI GCNGC 1 cut(s) 82
BlsI GCNGC 1 cut(s) 83
BmiI GGNNCC 1 cut(s) 121
BseGI GGATG 1 cut(s) 10
BseXI GCAGC 1 cut(s) 68
BsmI GAATGC 1 cut(s) 36
BspACI CCGC 1 cut(s) 124
BspLI GGNNCC 1 cut(s) 121
BstAPI GCANNNNNTGC 1 cut(s) 181
BstC8I GCNNGC 2 cut(s) 36, 156
BstF5I GGATG 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 181
BstV1I GCAGC 1 cut(s) 68
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 2 cut(s) 36, 156
CaiI CAGNNNCTG 1 cut(s) 181
CviAII CATG 2 cut(s) 65, 114
CviJI RGCY 2 cut(s) 38, 154
CviKI_1 RGCY 2 cut(s) 38, 154
FaeI CATG 2 cut(s) 68, 117
FaiI YATR 5 cut(s) 66, 75, 115, 163, 173
FatI CATG 2 cut(s) 64, 113
FauI CCCGC 1 cut(s) 131
Fnu4HI GCNGC 1 cut(s) 82
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 1 cut(s) 82
FspBI CTAG 1 cut(s) 168
GluI GCNGC 1 cut(s) 82
Hin1II CATG 2 cut(s) 68, 117
HpyCH4V TGCA 4 cut(s) 34, 158, 175, 184
HpyF10VI GCNNNNNNNGC 1 cut(s) 181
Hsp92II CATG 2 cut(s) 68, 117
LmnI GCTCC 1 cut(s) 151
Lsp1109I GCAGC 1 cut(s) 68
MaeI CTAG 1 cut(s) 168
MboII GAAGA 1 cut(s) 59
MluCI AATT 1 cut(s) 50
MmeI TCCRAC 1 cut(s) 129
Mva1269I GAATGC 1 cut(s) 36
MwoI GCNNNNNNNGC 1 cut(s) 181
NlaIII CATG 2 cut(s) 68, 117
NlaIV GGNNCC 1 cut(s) 121
PctI GAATGC 1 cut(s) 36
PkrI GCNGC 1 cut(s) 83
PspN4I GGNNCC 1 cut(s) 121
PstNI CAGNNNCTG 1 cut(s) 181
SatI GCNGC 1 cut(s) 82
SetI ASST 3 cut(s) 40, 133, 156
SgeI CNNG 9 cut(s) 39, 47, 77, 126, 135, 148, 157, 167, 180
Sse9I AATT 1 cut(s) 50
SsiI CCGC 1 cut(s) 124
SspMI CTAG 1 cut(s) 168
TasI AATT 1 cut(s) 50
TseI GCWGC 1 cut(s) 81
TspDTI ATGAA 1 cut(s) 21
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.