Rh5BG360400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
56297406 .. 56297747
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG360400.1

Sequence Viewer

Length: 342 bp
ATGTCGACCTCCTACAACAACGACAGTAACTATAGCATATATGTGACGACTTATAGCAAAGGTTTTCCCGACGTAAAATCGCTTTCGAGTCCTCGTGTCTCAATTCTTTGGAATGTCATCAGAAGATACAACTCAGAGAACCTCAGCTTCATCGAAGACCACAATTCAAGCCACACATTTGATGATATATTTGCGTCAATCGCATCTACCAATAATGATTATATGTCACCTCAATCGCGGGATACTATCTCCACGATGATATCTCGTATAAACTTCCACTTTGAATTAGATAGGCTGATAGGCTACGCTGGAAAGTTCGTTTCGATTGCAATAACACAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

12.93

Weight (kDa)

5.81

Isoelectric Point (pI)

56.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 5
AccII CGCG 1 cut(s) 238
AciI CCGC 1 cut(s) 238
AgsI TTSAA 2 cut(s) 168, 284
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
Alw26I GTCTC 1 cut(s) 103
AsuHPI GGTGA 1 cut(s) 219
BauI CACGAG 1 cut(s) 93
BbsI GAAGAC 1 cut(s) 162
BbvCI CCTCAGC 1 cut(s) 143
BciVI GTATCC 1 cut(s) 235
BcoDI GTCTC 1 cut(s) 103
BfmI CTRYAG 1 cut(s) 31
BfuI GTATCC 1 cut(s) 235
BmsI GCATC 1 cut(s) 212
BpiI GAAGAC 1 cut(s) 162
Bpu10I CCTNAGC 1 cut(s) 143
BseMII CTCAG 2 cut(s) 147, 157
Bsh1236I CGCG 1 cut(s) 238
BsmAI GTCTC 1 cut(s) 103
BspACI CCGC 1 cut(s) 238
BspCNI CTCAG 2 cut(s) 146, 156
BspFNI CGCG 1 cut(s) 238
BssSI CACGAG 1 cut(s) 93
Bst2BI CACGAG 1 cut(s) 93
Bst4CI ACNGT 1 cut(s) 26
BstDEI CTNAG 2 cut(s) 133, 143
BstFNI CGCG 1 cut(s) 238
BstMAI GTCTC 1 cut(s) 103
BstMWI GCNNNNNNNGC 1 cut(s) 200
BstSFI CTRYAG 1 cut(s) 31
BstUI CGCG 1 cut(s) 238
BstV2I GAAGAC 1 cut(s) 162
BsuI GTATCC 1 cut(s) 235
CseI GACGC 1 cut(s) 183
CviJI RGCY 4 cut(s) 147, 171, 295, 303
CviKI_1 RGCY 4 cut(s) 147, 171, 295, 303
DdeI CTNAG 2 cut(s) 133, 143
Eco32I GATATC 1 cut(s) 261
EcoRV GATATC 1 cut(s) 261
FaiI YATR 9 cut(s) 33, 38, 40, 42, 54, 188, 222, 224, 269
FauI CCCGC 1 cut(s) 231
FblI GTMKAC 1 cut(s) 5
HgaI GACGC 1 cut(s) 183
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HinfI GANTC 1 cut(s) 88
HphI GGTGA 1 cut(s) 219
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 2 cut(s) 122, 136
Hpy188III TCNNGA 1 cut(s) 68
Hpy8I GTNNAC 1 cut(s) 6
Hpy99I CGWCG 1 cut(s) 74
HpyCH4III ACNGT 1 cut(s) 26
HpyCH4IV ACGT 1 cut(s) 72
HpyCH4V TGCA 1 cut(s) 329
HpyF10VI GCNNNNNNNGC 1 cut(s) 200
HpyF3I CTNAG 2 cut(s) 133, 143
HpySE526I ACGT 1 cut(s) 72
LpnPI CCDG 1 cut(s) 294
LweI GCATC 1 cut(s) 212
MaeII ACGT 1 cut(s) 72
MaeIII GTNAC 3 cut(s) 26, 43, 225
MboII GAAGA 2 cut(s) 135, 167
MluCI AATT 3 cut(s) 102, 163, 284
MlyI GAGTC 1 cut(s) 97
MnlI CCTC 4 cut(s) 19, 102, 152, 240
MslI CAYNNNNRTG 1 cut(s) 41
MvnI CGCG 1 cut(s) 238
MwoI GCNNNNNNNGC 1 cut(s) 200
NmuCI GTSAC 2 cut(s) 43, 225
PleI GAGTC 1 cut(s) 96
PpsI GAGTC 1 cut(s) 96
RseI CAYNNNNRTG 1 cut(s) 41
SalI GTCGAC 1 cut(s) 4
SchI GAGTC 1 cut(s) 97
SetI ASST 6 cut(s) 11, 64, 75, 144, 149, 232
SfaNI GCATC 1 cut(s) 212
SfcI CTRYAG 1 cut(s) 31
SmiMI CAYNNNNRTG 1 cut(s) 41
Sse9I AATT 3 cut(s) 102, 163, 284
SsiI CCGC 1 cut(s) 238
TaaI ACNGT 1 cut(s) 26
TaiI ACGT 1 cut(s) 75
TaqI TCGA 4 cut(s) 5, 86, 153, 323
TasI AATT 3 cut(s) 102, 163, 284
TseFI GTSAC 2 cut(s) 43, 225
Tsp45I GTSAC 2 cut(s) 43, 225
TspDTI ATGAA 1 cut(s) 139
XmiI GTMKAC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.