Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr1

Orthogroup ID

OG0001375

Physical Location & Seq

Genomic Coordinates Forward (+)

67756113 .. 67757373

Gene Structure 1261 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw1G040500.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 624 bp

ATGGTGAAGCACAATAATGTTATTCCTGGGGAGCACTTCAGGAAGCACTGGCAGAACTATGTCAAGACCTGGTTTAACCAACCAGCAAGGAAGACCAGGAGGAGAAATGCTCGCCAGGCAAAGGCTGTGAAAATCTTTCCTAGGCCTACTGCTGGACCTCTCCGTCCAGTTGTTCGTGGACAGACATTGAAGTATAACATGAAGGTCAGGGCTGGTCGTGGCTTCACTCTGGAAGAGTTGAAGGCTGCTGGAATTCCAAGGAAACTTGCACCAACCATCGGTATCTCGGTTGATCATCGCAGGAAGAACCGTTCTCTTGAGGGGTTTCAAACTAATGTGCTTCGCTTGAAGACATACAAGCAGAAGTTGGTTGTCTTCCCAAGGCGTGCTGGCAAGTTCAAGGCTGGTGATTCTGCAGCAGAGGAGCTAGCAAATGCAACCCAGCTCCAAGGTCCTCTCTTGGCAATTCAACAGGAGAAACCTGTCACTGAGCTTGTGAAGGTCACTGCAGATATGAAGAAAGTCAATGCATATGACAAGCTCCGTATTGAGCGGGTCAATGTCCGTCATGTTGGGGCCAGGGCAAAGAAGGCTGCTGAGGCTGAGAAGGAAGAAAAGAAGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L13e

Protein Analysis

207

Amino Acids

23.63

Weight (kDa)

11.07

Isoelectric Point (pI)

36.43

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ribosomal_L13e	PF01294	7 - 185	1.5e-77	Ribosomal protein L13e

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001375)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G49010 AT3G49010 AT3G49010 AT3G49010 AT3G49010 AT3G49010 AT5G23900
fragaria_vesca	FvH4_7g33460 FvH4_7g33460 FvH4_7g33460 FvH4_7g33460 FvH4_7g33460 FvH4_7g33500
malus_domestica	MD01G1232600.v1.1 MD03G1289100.v1.1 MD11G1308800.v1.1
prunus_persica	Prupe.2G323200_v2.0.a1 Prupe.2G323200_v2.0.a1 Prupe.2G323200_v2.0.a1 Prupe.5G019600_v2.0.a1 Prupe.5G019600_v2.0.a1 Prupe.5G019600_v2.0.a1
pyrus_communis	pycom04g06880 pycom07g27760 pycom11g27020
rosa_chinensis	RchiOBHm_Chr1g0380821 RchiOBHm_Chr1g0383541 RchiOBHm_Chr2g0116901
rosa_laevigata	RLG00000018312 RLG00000026101 RLG00000026270
rosa_multiflora	Rmu_sc0002962.1_g000012 Rmu_sc0005884.1_g000001 Rmu_sc0012471.1_g000015 Rmu_sc0012636.1_g000001
rosa_roxburghii	Rroxscaffold_2G00126900 Rroxscaffold_4G00277290
rosa_rugosa	Rorug01G0441900
rosa_samantha	Rh1AG448700 Rh1AG467400 Rh1BG404300 Rh1BG425000 Rh1CG418400 Rh1CG437700 Rh1DG434700 Rh1DG457800 Rh2AG264900 Rh2BG276400 Rh2DG272300 Rh2DG291100
rosa_wichuraiana	Rw1G039050 Rw1G040500 Rw2G020870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	162
AccBSI	CCGCTC	1 cut(s)	553
AciI	CCGC	1 cut(s)	553
AcsI	RAATTY	1 cut(s)	252
AcuI	CTGAAG	1 cut(s)	22
AfiI	CCNNNNNNNGG	3 cut(s)	121, 152, 278
AgsI	TTSAA	6 cut(s)	190, 241, 329, 349, 400, 470
AjnI	CCWGG	5 cut(s)	25, 68, 95, 114, 578
AloI	GAACNNNNNNTCC	2 cut(s)	295, 327
AluBI	AGCT	4 cut(s)	427, 445, 493, 541
AluI	AGCT	4 cut(s)	427, 445, 493, 541
Alw21I	GWGCWC	1 cut(s)	36
AoxI	GGCC	2 cut(s)	143, 576
ApeKI	GCWGC	3 cut(s)	245, 416, 593
ApoI	RAATTY	1 cut(s)	252
AspA2I	CCTAGG	1 cut(s)	140
AspS9I	GGNCC	3 cut(s)	155, 452, 576
AsuHPI	GGTGA	2 cut(s)	16, 419
AsuNHI	GCTAGC	1 cut(s)	427
AvaII	GGWCC	2 cut(s)	155, 452
AvrII	CCTAGG	1 cut(s)	140
BbsI	GAAGAC	3 cut(s)	98, 356, 367
Bbv12I	GWGCWC	1 cut(s)	36
BbvCI	CCTCAGC	1 cut(s)	597
BbvI	GCAGC	3 cut(s)	232, 428, 580
BccI	CCATC	1 cut(s)	284
BciT130I	CCWGG	5 cut(s)	27, 70, 97, 116, 580
BclI	TGATCA	1 cut(s)	292
BfaI	CTAG	2 cut(s)	141, 428
BfmI	CTRYAG	2 cut(s)	414, 507
BisI	GCNGC	3 cut(s)	246, 417, 594
BlnI	CCTAGG	1 cut(s)	140
BlsI	GCNGC	3 cut(s)	247, 418, 595
Bme1390I	CCNGG	5 cut(s)	27, 70, 97, 116, 580
Bme18I	GGWCC	2 cut(s)	155, 452
BmgT120I	GGNCC	3 cut(s)	155, 452, 576
BmiI	GGNNCC	1 cut(s)	577
BmrFI	CCNGG	5 cut(s)	27, 70, 97, 116, 580
BmtI	GCTAGC	1 cut(s)	431
BpiI	GAAGAC	3 cut(s)	98, 356, 367
BplI	GAGNNNNNCTC	2 cut(s)	94, 126
Bpu10I	CCTNAGC	1 cut(s)	597
BpuEI	CTTGAG	1 cut(s)	338
BsaJI	CCNNGG	6 cut(s)	26, 140, 257, 380, 448, 579
Bsc4I	CCNNNNNNNGG	3 cut(s)	121, 152, 278
Bse1I	ACTGG	2 cut(s)	53, 167
BseBI	CCWGG	5 cut(s)	27, 70, 97, 116, 580
BseDI	CCNNGG	6 cut(s)	26, 140, 257, 380, 448, 579
BseLI	CCNNNNNNNGG	3 cut(s)	121, 152, 278
BseMII	CTCAG	3 cut(s)	480, 588, 594
BseNI	ACTGG	2 cut(s)	53, 167
BseRI	GAGGAG	2 cut(s)	115, 437
BseXI	GCAGC	3 cut(s)	232, 428, 580
BseYI	CCCAGC	1 cut(s)	441
BshFI	GGCC	2 cut(s)	145, 578
BsiHKAI	GWGCWC	1 cut(s)	36
BslI	CCNNNNNNNGG	3 cut(s)	121, 152, 278
BsnI	GGCC	2 cut(s)	145, 578
Bsp1286I	GDGCHC	1 cut(s)	36
Bsp143I	GATC	1 cut(s)	292
BspACI	CCGC	1 cut(s)	553
BspANI	GGCC	2 cut(s)	145, 578
BspCNI	CTCAG	3 cut(s)	481, 589, 595
BspLI	GGNNCC	1 cut(s)	577
BspMAI	CTGCAG	2 cut(s)	418, 511
BspOI	GCTAGC	1 cut(s)	431
BsrBI	CCGCTC	1 cut(s)	553
BsrI	ACTGG	2 cut(s)	53, 167
BssECI	CCNNGG	6 cut(s)	26, 140, 257, 380, 448, 579
BssMI	GATC	1 cut(s)	292
BssT1I	CCWWGG	4 cut(s)	140, 257, 380, 448
Bst2UI	CCWGG	5 cut(s)	27, 70, 97, 116, 580
Bst4CI	ACNGT	1 cut(s)	311
Bst6I	CTCTTC	1 cut(s)	228
BstC8I	GCNNGC	4 cut(s)	112, 387, 391, 429
BstDEI	CTNAG	3 cut(s)	489, 597, 603
BstKTI	GATC	1 cut(s)	295
BstMBI	GATC	1 cut(s)	292
BstMWI	GCNNNNNNNGC	3 cut(s)	116, 590, 599
BstNI	CCWGG	5 cut(s)	27, 70, 97, 116, 580
BstSCI	CCNGG	5 cut(s)	25, 68, 95, 114, 578
BstSFI	CTRYAG	2 cut(s)	414, 507
BstV1I	GCAGC	3 cut(s)	232, 428, 580
BstV2I	GAAGAC	3 cut(s)	98, 356, 367
BsuRI	GGCC	2 cut(s)	145, 578
BtgZI	GCGATG	1 cut(s)	281
BtsI	GCAGTG	1 cut(s)	504
BtsIMutI	CAGTG	3 cut(s)	46, 486, 504
Cac8I	GCNNGC	4 cut(s)	112, 387, 391, 429
Cfr13I	GGNCC	3 cut(s)	155, 452, 576
CsiI	ACCWGGT	1 cut(s)	68
CviAII	CATG	2 cut(s)	199, 569
DdeI	CTNAG	3 cut(s)	489, 597, 603
DpnI	GATC	1 cut(s)	294
DpnII	GATC	1 cut(s)	292
DrdI	GACNNNNNNGTC	1 cut(s)	162
DseDI	GACNNNNNNGTC	1 cut(s)	162
Eam1104I	CTCTTC	1 cut(s)	228
EarI	CTCTTC	1 cut(s)	228
Eco130I	CCWWGG	4 cut(s)	140, 257, 380, 448
Eco147I	AGGCCT	1 cut(s)	145
Eco47I	GGWCC	2 cut(s)	155, 452
Eco57I	CTGAAG	1 cut(s)	22
EcoO109I	RGGNCCY	1 cut(s)	452
EcoRI	GAATTC	1 cut(s)	252
EcoRII	CCWGG	5 cut(s)	25, 68, 95, 114, 578
EcoT14I	CCWWGG	4 cut(s)	140, 257, 380, 448
EcoT22I	ATGCAT	1 cut(s)	532
ErhI	CCWWGG	4 cut(s)	140, 257, 380, 448
FaeI	CATG	2 cut(s)	202, 572
FaiI	YATR	8 cut(s)	60, 195, 200, 355, 515, 532, 534, 570
FatI	CATG	2 cut(s)	198, 568
FauI	CCCGC	1 cut(s)	546
FauNDI	CATATG	1 cut(s)	532
FbaI	TGATCA	1 cut(s)	292
Fnu4HI	GCNGC	3 cut(s)	246, 417, 594
Fsp4HI	GCNGC	3 cut(s)	246, 417, 594
FspBI	CTAG	2 cut(s)	141, 428
GluI	GCNGC	3 cut(s)	246, 417, 594
GsaI	CCCAGC	1 cut(s)	445
HaeIII	GGCC	2 cut(s)	145, 578
Hin1II	CATG	2 cut(s)	202, 572
HinfI	GANTC	1 cut(s)	410
HphI	GGTGA	2 cut(s)	16, 419
Hpy166II	GTNNAC	1 cut(s)	179
Hpy188III	TCNNGA	4 cut(s)	40, 64, 230, 317
Hpy8I	GTNNAC	1 cut(s)	179
HpyAV	CCTTC	5 cut(s)	196, 235, 493, 583, 601
HpyCH4III	ACNGT	1 cut(s)	311
HpyCH4V	TGCA	5 cut(s)	269, 416, 437, 509, 530
HpyF10VI	GCNNNNNNNGC	3 cut(s)	116, 590, 599
HpyF3I	CTNAG	3 cut(s)	489, 597, 603
Hsp92II	CATG	2 cut(s)	202, 572
Ksp22I	TGATCA	1 cut(s)	292
Kzo9I	GATC	1 cut(s)	292
LmnI	GCTCC	4 cut(s)	31, 424, 450, 546
Lsp1109I	GCAGC	3 cut(s)	232, 428, 580
MabI	ACCWGGT	1 cut(s)	68
MaeI	CTAG	2 cut(s)	141, 428
MaeIII	GTNAC	2 cut(s)	484, 502
MalI	GATC	1 cut(s)	294
MbiI	CCGCTC	1 cut(s)	553
MboI	GATC	1 cut(s)	292
MboII	GAAGA	7 cut(s)	103, 245, 316, 361, 367, 529, 623
MhlI	GDGCHC	1 cut(s)	36
MluCI	AATT	2 cut(s)	252, 465
MnlI	CCTC	6 cut(s)	93, 168, 313, 415, 465, 592
Mph1103I	ATGCAT	1 cut(s)	532
MseI	TTAA	1 cut(s)	75
MslI	CAYNNNNRTG	1 cut(s)	15
MspR9I	CCNGG	5 cut(s)	27, 70, 97, 116, 580
MvaI	CCWGG	5 cut(s)	27, 70, 97, 116, 580
MwoI	GCNNNNNNNGC	3 cut(s)	116, 590, 599
NdeI	CATATG	1 cut(s)	532
NdeII	GATC	1 cut(s)	292
NheI	GCTAGC	1 cut(s)	427
NlaIII	CATG	2 cut(s)	202, 572
NlaIV	GGNNCC	1 cut(s)	577
NmuCI	GTSAC	2 cut(s)	484, 502
NsiI	ATGCAT	1 cut(s)	532
PceI	AGGCCT	1 cut(s)	145
PfeI	GAWTC	1 cut(s)	410
PkrI	GCNGC	3 cut(s)	247, 418, 595
PpuMI	RGGWCCY	1 cut(s)	452
Psp5II	RGGWCCY	1 cut(s)	452
Psp6I	CCWGG	5 cut(s)	25, 68, 95, 114, 578
PspFI	CCCAGC	1 cut(s)	441
PspGI	CCWGG	5 cut(s)	25, 68, 95, 114, 578
PspN4I	GGNNCC	1 cut(s)	577
PspPI	GGNCC	3 cut(s)	155, 452, 576
PspPPI	RGGWCCY	1 cut(s)	452
PstI	CTGCAG	2 cut(s)	418, 511
RseI	CAYNNNNRTG	1 cut(s)	15
SaqAI	TTAA	1 cut(s)	75
SatI	GCNGC	3 cut(s)	246, 417, 594
Sau3AI	GATC	1 cut(s)	292
Sau96I	GGNCC	3 cut(s)	155, 452, 576
ScrFI	CCNGG	5 cut(s)	27, 70, 97, 116, 580
SduI	GDGCHC	1 cut(s)	36
SexAI	ACCWGGT	1 cut(s)	68
SfcI	CTRYAG	2 cut(s)	414, 507
SinI	GGWCC	2 cut(s)	155, 452
SmiMI	CAYNNNNRTG	1 cut(s)	15
SmlI	CTYRAG	1 cut(s)	317
SmoI	CTYRAG	1 cut(s)	317
Sse9I	AATT	2 cut(s)	252, 465
SseBI	AGGCCT	1 cut(s)	145
SsiI	CCGC	1 cut(s)	553
SspMI	CTAG	2 cut(s)	141, 428
StuI	AGGCCT	1 cut(s)	145
StyD4I	CCNGG	5 cut(s)	25, 68, 95, 114, 578
StyI	CCWWGG	4 cut(s)	140, 257, 380, 448
TaaI	ACNGT	1 cut(s)	311
TasI	AATT	2 cut(s)	252, 465
TfiI	GAWTC	1 cut(s)	410
Tru1I	TTAA	1 cut(s)	75
Tru9I	TTAA	1 cut(s)	75
TscAI	CASTG	3 cut(s)	53, 493, 511
TseFI	GTSAC	2 cut(s)	484, 502
TseI	GCWGC	3 cut(s)	245, 416, 593
Tsp45I	GTSAC	2 cut(s)	484, 502
TspDTI	ATGAA	2 cut(s)	215, 530
TspGWI	ACGGA	3 cut(s)	152, 533, 554
TspRI	CASTG	3 cut(s)	53, 493, 511
VpaK11BI	GGWCC	2 cut(s)	155, 452
XapI	RAATTY	1 cut(s)	252
XmaJI	CCTAGG	1 cut(s)	140
XspI	CTAG	2 cut(s)	141, 428
Zsp2I	ATGCAT	1 cut(s)	532

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.