AT1G72510

Protein of unknown function (DUF1677)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0002944
Physical Location & Seq
Forward (+)
27303323 .. 27304927
1605 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G72510.1

Sequence Viewer

Length: 498 bp
ATGTCTGCGAGTGTTCTAAGTGATCCAACAATGCTAATTTCAACACCGGAGGTAATACTCGTCTCTCCGGTATCGGTTACTCAAATCTCCGGAGATGAGCCAGATTCGGTGACGTGTGATTGTTGCGGATTAACCGAGGAGTGTACCCAATCGTACATAGAGATGGTCAGAGAGCGTTACATGGGGAAATGGATCTGTGGACTTTGTTCTGAAGCTGTGAAGTATGAAGTCATGAGAACGAAAAGATTGTTAACGACAGAGGAAGCTATGGCCAGACACATGAACATGTGTAATAAGTTCAAATCCTCAAGCCCACCACCGAATCCGACAGGACATTTGATCTCTGCCATGAGACAGATCTTGAGAAAAAGCTTAGATTCACCAAGAATGCTTAGATCTATGCCTAATAGTCCATCTAAAGACGACCAAGATCATCATCATGATTGTGTTTCTAATGTTTTGTCTAGGTCTGATAGCTGTTTCGCTAGTTTGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1677

Protein Analysis

165

Amino Acids

18.36

Weight (kDa)

5.93

Isoelectric Point (pI)

73.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1677 PF07911 35 - 127 6.9e-41 Protein of unknown function (DUF1677)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 89
AciI CCGC 1 cut(s) 126
AclWI GGATC 2 cut(s) 17, 200
AcoI YGGCCR 1 cut(s) 270
AcuI CTGAAG 1 cut(s) 231
AfaI GTAC 2 cut(s) 145, 155
AflIII ACRYGT 2 cut(s) 113, 285
AgsI TTSAA 2 cut(s) 42, 301
AjiI CACGTC 1 cut(s) 114
AluBI AGCT 4 cut(s) 215, 266, 372, 477
AluI AGCT 4 cut(s) 215, 266, 372, 477
Alw26I GTCTC 2 cut(s) 67, 346
AlwI GGATC 2 cut(s) 17, 200
Aor13HI TCCGGA 1 cut(s) 89
AoxI GGCC 1 cut(s) 270
ArsI GACNNNNNNTTYG 2 cut(s) 319, 351
AsuHPI GGTGA 2 cut(s) 121, 372
BalI TGGCCA 1 cut(s) 272
BccI CCATC 2 cut(s) 157, 421
BcoDI GTCTC 2 cut(s) 67, 346
BfaI CTAG 2 cut(s) 465, 486
BglII AGATCT 2 cut(s) 357, 395
BmgBI CACGTC 1 cut(s) 114
BpuEI CTTGAG 2 cut(s) 292, 382
BsaBI GATNNNNATC 1 cut(s) 435
BsaJI CCNNGG 1 cut(s) 135
BsaWI WCCGGW 3 cut(s) 46, 67, 89
Bse8I GATNNNNATC 1 cut(s) 435
BseAI TCCGGA 1 cut(s) 89
BseDI CCNNGG 1 cut(s) 135
BseJI GATNNNNATC 1 cut(s) 435
BseRI GAGGAG 1 cut(s) 152
BshFI GGCC 1 cut(s) 272
BsiSI CCGG 3 cut(s) 47, 68, 90
BsmAI GTCTC 2 cut(s) 67, 346
BsmBI CGTCTC 1 cut(s) 67
BsmI GAATGC 1 cut(s) 393
BsnI GGCC 1 cut(s) 272
Bsp13I TCCGGA 1 cut(s) 89
Bsp143I GATC 6 cut(s) 22, 192, 339, 357, 395, 430
BspACI CCGC 1 cut(s) 126
BspANI GGCC 1 cut(s) 272
BspEI TCCGGA 1 cut(s) 89
BspHI TCATGA 2 cut(s) 231, 439
BspPI GGATC 2 cut(s) 17, 200
BssECI CCNNGG 1 cut(s) 135
BssMI GATC 6 cut(s) 22, 192, 339, 357, 395, 430
BstDEI CTNAG 3 cut(s) 17, 373, 392
BstKTI GATC 6 cut(s) 25, 195, 342, 360, 398, 433
BstMAI GTCTC 2 cut(s) 67, 346
BstMBI GATC 6 cut(s) 22, 192, 339, 357, 395, 430
BstNSI RCATGY 1 cut(s) 289
BstX2I RGATCY 3 cut(s) 192, 357, 395
BstYI RGATCY 3 cut(s) 192, 357, 395
BsuRI GGCC 1 cut(s) 272
BtrI CACGTC 1 cut(s) 114
CciI TCATGA 2 cut(s) 231, 439
Csp6I GTAC 2 cut(s) 144, 154
CviAII CATG 6 cut(s) 181, 232, 280, 286, 349, 440
CviJI RGCY 7 cut(s) 100, 215, 266, 272, 312, 372, 477
CviKI_1 RGCY 7 cut(s) 100, 215, 266, 272, 312, 372, 477
CviQI GTAC 2 cut(s) 144, 154
DdeI CTNAG 3 cut(s) 17, 373, 392
DpnI GATC 6 cut(s) 24, 194, 341, 359, 397, 432
DpnII GATC 6 cut(s) 22, 192, 339, 357, 395, 430
EaeI YGGCCR 1 cut(s) 270
Eco57I CTGAAG 1 cut(s) 231
Esp3I CGTCTC 1 cut(s) 67
FaeI CATG 6 cut(s) 184, 235, 283, 289, 352, 443
FatI CATG 6 cut(s) 180, 231, 279, 285, 348, 439
FspBI CTAG 2 cut(s) 465, 486
HaeIII GGCC 1 cut(s) 272
HapII CCGG 3 cut(s) 47, 68, 90
Hin1II CATG 6 cut(s) 184, 235, 283, 289, 352, 443
HincII GTYRAC 1 cut(s) 252
HindII GTYRAC 1 cut(s) 252
HindIII AAGCTT 1 cut(s) 370
HinfI GANTC 3 cut(s) 104, 322, 377
HpaI GTTAAC 1 cut(s) 252
HpaII CCGG 3 cut(s) 47, 68, 90
HphI GGTGA 2 cut(s) 121, 372
Hpy166II GTNNAC 3 cut(s) 144, 200, 252
Hpy188I TCNGA 4 cut(s) 170, 211, 327, 472
Hpy188III TCNNGA 4 cut(s) 90, 232, 361, 440
Hpy8I GTNNAC 3 cut(s) 144, 200, 252
HpyCH4IV ACGT 1 cut(s) 113
HpyF3I CTNAG 3 cut(s) 17, 373, 392
HpySE526I ACGT 1 cut(s) 113
Hsp92II CATG 6 cut(s) 184, 235, 283, 289, 352, 443
Kpn2I TCCGGA 1 cut(s) 89
KspAI GTTAAC 1 cut(s) 252
Kzo9I GATC 6 cut(s) 22, 192, 339, 357, 395, 430
LpnPI CCDG 6 cut(s) 60, 81, 103, 114, 286, 315
MaeI CTAG 2 cut(s) 465, 486
MaeII ACGT 1 cut(s) 113
MaeIII GTNAC 3 cut(s) 76, 109, 176
MalI GATC 6 cut(s) 24, 194, 341, 359, 397, 432
MboI GATC 6 cut(s) 22, 192, 339, 357, 395, 430
MflI RGATCY 3 cut(s) 192, 357, 395
MlsI TGGCCA 1 cut(s) 272
MluCI AATT 1 cut(s) 36
MluNI TGGCCA 1 cut(s) 272
MmeI TCCRAC 2 cut(s) 50, 350
MnlI CCTC 4 cut(s) 43, 130, 253, 316
Mox20I TGGCCA 1 cut(s) 272
MroI TCCGGA 1 cut(s) 89
MscI TGGCCA 1 cut(s) 272
MseI TTAA 2 cut(s) 131, 251
MslI CAYNNNNRTG 4 cut(s) 161, 284, 438, 444
Msp20I TGGCCA 1 cut(s) 272
MspI CCGG 3 cut(s) 47, 68, 90
Mva1269I GAATGC 1 cut(s) 393
NdeII GATC 6 cut(s) 22, 192, 339, 357, 395, 430
NlaIII CATG 6 cut(s) 184, 235, 283, 289, 352, 443
NmuCI GTSAC 1 cut(s) 109
NspI RCATGY 1 cut(s) 289
PagI TCATGA 2 cut(s) 231, 439
PciI ACATGT 1 cut(s) 285
PctI GAATGC 1 cut(s) 393
PfeI GAWTC 3 cut(s) 104, 322, 377
PscI ACATGT 1 cut(s) 285
PsuI RGATCY 3 cut(s) 192, 357, 395
RsaI GTAC 2 cut(s) 145, 155
RsaNI GTAC 2 cut(s) 144, 154
RseI CAYNNNNRTG 4 cut(s) 161, 284, 438, 444
SaqAI TTAA 2 cut(s) 131, 251
Sau3AI GATC 6 cut(s) 22, 192, 339, 357, 395, 430
SetI ASST 7 cut(s) 54, 116, 217, 268, 374, 470, 479
SmiMI CAYNNNNRTG 4 cut(s) 161, 284, 438, 444
SmlI CTYRAG 2 cut(s) 307, 361
SmoI CTYRAG 2 cut(s) 307, 361
Sse9I AATT 1 cut(s) 36
SsiI CCGC 1 cut(s) 126
SspMI CTAG 2 cut(s) 465, 486
TaiI ACGT 1 cut(s) 116
TasI AATT 1 cut(s) 36
TfiI GAWTC 3 cut(s) 104, 322, 377
Tru1I TTAA 2 cut(s) 131, 251
Tru9I TTAA 2 cut(s) 131, 251
TseFI GTSAC 1 cut(s) 109
Tsp45I GTSAC 1 cut(s) 109
TspDTI ATGAA 2 cut(s) 240, 296
XceI RCATGY 1 cut(s) 289
XspI CTAG 2 cut(s) 465, 486
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.