AT2G09970

Protein of unknown function (DUF1677)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0002944
Physical Location & Seq
Reverse (-)
3779992 .. 3780691
700 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G09970.1

Sequence Viewer

Length: 501 bp
ATGTCTGATAGTGTACTTAGTGATCCAACAATGTTAATTTCAACACCGGATGTAATAATTATCTCAACGGTTCCGGTGACACAAATATCCAGCGATGAGCTAGATTCGGTGACGTGTGACTGTTGCGGATTAACCGACGAGTGTACAGAATCGTACACAGAGATGATAAGAGAGCGTTACATAGGGAAATGGATCTCTGGATTTTGTTCTGAAGCTGTGAAGTACAAAGTCATGAGAACAAAAAGATTTTTAACAACAGAAGAAGAAGCTATGGCGAGACACATGAACAAGTGTAATAAGTTCAAATCCTCAAGCCCACCATCGAATCTGACAAGACATTTGATCTCTGCGATGAGACAGATCTTGAGAAAAAGCTTAGATTCACCAAGAATGCTTAGATCTATGCCTAATAGTCCATCTAAAGACGATCAAGATAATCATCATGATTGTGTTTCTAATGTTTTGTCTAGGTCTGATAGCTGTTTCGCTAGTTTGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1677

Protein Analysis

166

Amino Acids

18.7

Weight (kDa)

6.07

Isoelectric Point (pI)

67.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1677 PF07911 35 - 128 6.6e-33 Protein of unknown function (DUF1677)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 126
AclWI GGATC 2 cut(s) 17, 200
AcuI CTGAAG 1 cut(s) 231
AfaI GTAC 4 cut(s) 15, 145, 155, 224
AflIII ACRYGT 1 cut(s) 113
AgsI TTSAA 2 cut(s) 42, 304
AjiI CACGTC 1 cut(s) 114
AluBI AGCT 5 cut(s) 100, 215, 269, 375, 480
AluI AGCT 5 cut(s) 100, 215, 269, 375, 480
Alw26I GTCTC 2 cut(s) 271, 349
AlwI GGATC 2 cut(s) 17, 200
ArsI GACNNNNNNTTYG 2 cut(s) 322, 354
AsuHPI GGTGA 3 cut(s) 88, 121, 375
BccI CCATC 2 cut(s) 328, 424
BcoDI GTCTC 2 cut(s) 271, 349
BfaI CTAG 3 cut(s) 101, 468, 489
BglII AGATCT 2 cut(s) 360, 398
BmgBI CACGTC 1 cut(s) 114
BmiI GGNNCC 1 cut(s) 72
BpuEI CTTGAG 2 cut(s) 295, 385
BsaBI GATNNNNATC 1 cut(s) 438
BsaWI WCCGGW 2 cut(s) 46, 73
Bse8I GATNNNNATC 1 cut(s) 438
BseGI GGATG 1 cut(s) 55
BseJI GATNNNNATC 1 cut(s) 438
BsiSI CCGG 2 cut(s) 47, 74
BsmAI GTCTC 2 cut(s) 271, 349
BsmI GAATGC 1 cut(s) 396
Bsp1407I TGTACA 1 cut(s) 143
Bsp143I GATC 6 cut(s) 22, 192, 342, 360, 398, 427
BspACI CCGC 1 cut(s) 126
BspHI TCATGA 2 cut(s) 231, 442
BspLI GGNNCC 1 cut(s) 72
BspPI GGATC 2 cut(s) 17, 200
BsrGI TGTACA 1 cut(s) 143
BssMI GATC 6 cut(s) 22, 192, 342, 360, 398, 427
Bst4CI ACNGT 2 cut(s) 70, 122
BstAUI TGTACA 1 cut(s) 143
BstDEI CTNAG 3 cut(s) 17, 376, 395
BstF5I GGATG 1 cut(s) 55
BstKTI GATC 6 cut(s) 25, 195, 345, 363, 401, 430
BstMAI GTCTC 2 cut(s) 271, 349
BstMBI GATC 6 cut(s) 22, 192, 342, 360, 398, 427
BstX2I RGATCY 3 cut(s) 192, 360, 398
BstYI RGATCY 3 cut(s) 192, 360, 398
BtgZI GCGATG 2 cut(s) 108, 365
BtrI CACGTC 1 cut(s) 114
BtsCI GGATG 1 cut(s) 55
CciI TCATGA 2 cut(s) 231, 442
Csp6I GTAC 4 cut(s) 14, 144, 154, 223
CviAII CATG 3 cut(s) 232, 283, 443
CviJI RGCY 6 cut(s) 100, 215, 269, 315, 375, 480
CviKI_1 RGCY 6 cut(s) 100, 215, 269, 315, 375, 480
CviQI GTAC 4 cut(s) 14, 144, 154, 223
DdeI CTNAG 3 cut(s) 17, 376, 395
DpnI GATC 6 cut(s) 24, 194, 344, 362, 400, 429
DpnII GATC 6 cut(s) 22, 192, 342, 360, 398, 427
Eco57I CTGAAG 1 cut(s) 231
FaeI CATG 3 cut(s) 235, 286, 446
FaiI YATR 6 cut(s) 182, 233, 272, 284, 404, 444
FatI CATG 3 cut(s) 231, 282, 442
FokI GGATG 1 cut(s) 62
FspBI CTAG 3 cut(s) 101, 468, 489
HapII CCGG 2 cut(s) 47, 74
Hin1II CATG 3 cut(s) 235, 286, 446
HindIII AAGCTT 1 cut(s) 373
HinfI GANTC 4 cut(s) 104, 149, 325, 380
HpaII CCGG 2 cut(s) 47, 74
HphI GGTGA 3 cut(s) 88, 121, 375
Hpy166II GTNNAC 3 cut(s) 14, 144, 156
Hpy188I TCNGA 4 cut(s) 7, 211, 330, 475
Hpy188III TCNNGA 5 cut(s) 198, 232, 364, 431, 443
Hpy8I GTNNAC 3 cut(s) 14, 144, 156
Hpy99I CGWCG 1 cut(s) 140
HpyCH4III ACNGT 2 cut(s) 70, 122
HpyCH4IV ACGT 1 cut(s) 113
HpyF3I CTNAG 3 cut(s) 17, 376, 395
HpySE526I ACGT 1 cut(s) 113
Hsp92II CATG 3 cut(s) 235, 286, 446
Kzo9I GATC 6 cut(s) 22, 192, 342, 360, 398, 427
LpnPI CCDG 4 cut(s) 60, 87, 103, 183
MaeI CTAG 3 cut(s) 101, 468, 489
MaeII ACGT 1 cut(s) 113
MaeIII GTNAC 4 cut(s) 76, 109, 116, 176
MalI GATC 6 cut(s) 24, 194, 344, 362, 400, 429
MboI GATC 6 cut(s) 22, 192, 342, 360, 398, 427
MboII GAAGA 2 cut(s) 272, 275
MflI RGATCY 3 cut(s) 192, 360, 398
MluCI AATT 2 cut(s) 36, 57
MmeI TCCRAC 1 cut(s) 50
MnlI CCTC 1 cut(s) 319
MseI TTAA 3 cut(s) 35, 131, 251
MslI CAYNNNNRTG 2 cut(s) 161, 447
MspI CCGG 2 cut(s) 47, 74
Mva1269I GAATGC 1 cut(s) 396
NdeII GATC 6 cut(s) 22, 192, 342, 360, 398, 427
NlaIII CATG 3 cut(s) 235, 286, 446
NlaIV GGNNCC 1 cut(s) 72
NmuCI GTSAC 3 cut(s) 76, 109, 116
PagI TCATGA 2 cut(s) 231, 442
PctI GAATGC 1 cut(s) 396
PfeI GAWTC 4 cut(s) 104, 149, 325, 380
PspN4I GGNNCC 1 cut(s) 72
PsuI RGATCY 3 cut(s) 192, 360, 398
RsaI GTAC 4 cut(s) 15, 145, 155, 224
RsaNI GTAC 4 cut(s) 14, 144, 154, 223
RseI CAYNNNNRTG 2 cut(s) 161, 447
SaqAI TTAA 3 cut(s) 35, 131, 251
Sau3AI GATC 6 cut(s) 22, 192, 342, 360, 398, 427
SetI ASST 7 cut(s) 102, 116, 217, 271, 377, 473, 482
SmiMI CAYNNNNRTG 2 cut(s) 161, 447
SmlI CTYRAG 2 cut(s) 310, 364
SmoI CTYRAG 2 cut(s) 310, 364
Sse9I AATT 2 cut(s) 36, 57
SsiI CCGC 1 cut(s) 126
SspMI CTAG 3 cut(s) 101, 468, 489
TaaI ACNGT 2 cut(s) 70, 122
TaiI ACGT 1 cut(s) 116
TaqI TCGA 1 cut(s) 323
TasI AATT 2 cut(s) 36, 57
TatI WGTACW 3 cut(s) 13, 143, 222
TfiI GAWTC 4 cut(s) 104, 149, 325, 380
Tru1I TTAA 3 cut(s) 35, 131, 251
Tru9I TTAA 3 cut(s) 35, 131, 251
TseFI GTSAC 3 cut(s) 76, 109, 116
Tsp45I GTSAC 3 cut(s) 76, 109, 116
TspDTI ATGAA 1 cut(s) 299
XspI CTAG 3 cut(s) 101, 468, 489
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.