AT4G31985

60s ribosomal protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Forward (+)
15469841 .. 15470733
893 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G31985.1

Sequence Viewer

Length: 156 bp
ATGCCGTCGCACAAGTCGTTTATGATTAAGAAGAAGTTGGGAAAGAAGATGAGACAGAACAGGCCTATTCCTCACTGGATTCGTCTTCGTACCGACAACACCATCAGGTACAATGCCAAGCGCAGGCACTGGCGTAGAACCAAGCTCGGATTCTAA

Protein Analysis

51

Amino Acids

6.42

Weight (kDa)

12.0

Isoelectric Point (pI)

64.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L39 PF00832 9 - 49 3.4e-22 Ribosomal L39 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 91, 110
AfiI CCNNNNNNNGG 1 cut(s) 123
AjuI GAANNNNNNNTTGG 1 cut(s) 134
AluBI AGCT 1 cut(s) 145
AluI AGCT 1 cut(s) 145
Alw26I GTCTC 1 cut(s) 46
AlwNI CAGNNNCTG 1 cut(s) 129
AoxI GGCC 1 cut(s) 62
AspLEI GCGC 1 cut(s) 123
BbsI GAAGAC 1 cut(s) 77
BccI CCATC 1 cut(s) 110
BcoDI GTCTC 1 cut(s) 46
BpiI GAAGAC 1 cut(s) 77
Bsc4I CCNNNNNNNGG 1 cut(s) 123
Bse1I ACTGG 2 cut(s) 80, 134
BseLI CCNNNNNNNGG 1 cut(s) 123
BseNI ACTGG 2 cut(s) 80, 134
BshFI GGCC 1 cut(s) 64
BslI CCNNNNNNNGG 1 cut(s) 123
BsmAI GTCTC 1 cut(s) 46
BsnI GGCC 1 cut(s) 64
BspANI GGCC 1 cut(s) 64
BsrI ACTGG 2 cut(s) 80, 134
BstC8I GCNNGC 1 cut(s) 125
BstHHI GCGC 1 cut(s) 123
BstMAI GTCTC 1 cut(s) 46
BstV2I GAAGAC 1 cut(s) 77
BsuRI GGCC 1 cut(s) 64
BtsIMutI CAGTG 2 cut(s) 73, 127
Cac8I GCNNGC 1 cut(s) 125
CaiI CAGNNNCTG 1 cut(s) 129
CfoI GCGC 1 cut(s) 123
Csp6I GTAC 2 cut(s) 90, 109
CviJI RGCY 2 cut(s) 64, 145
CviKI_1 RGCY 2 cut(s) 64, 145
CviQI GTAC 2 cut(s) 90, 109
Eco147I AGGCCT 1 cut(s) 64
FaiI YATR 1 cut(s) 23
GlaI GCGC 1 cut(s) 122
HaeIII GGCC 1 cut(s) 64
HhaI GCGC 1 cut(s) 123
Hin6I GCGC 1 cut(s) 121
HinP1I GCGC 1 cut(s) 121
HinfI GANTC 2 cut(s) 79, 150
Hpy188I TCNGA 1 cut(s) 149
Hpy99I CGWCG 1 cut(s) 10
HspAI GCGC 1 cut(s) 121
LpnPI CCDG 5 cut(s) 46, 61, 91, 109, 115
MboII GAAGA 3 cut(s) 43, 58, 77
MnlI CCTC 1 cut(s) 81
MseI TTAA 1 cut(s) 27
PceI AGGCCT 1 cut(s) 64
PcsI WCGNNNNNNNCGW 1 cut(s) 14
PfeI GAWTC 2 cut(s) 79, 150
PstNI CAGNNNCTG 1 cut(s) 129
RsaI GTAC 2 cut(s) 91, 110
RsaNI GTAC 2 cut(s) 90, 109
SaqAI TTAA 1 cut(s) 27
SetI ASST 2 cut(s) 110, 147
SgeI CNNG 7 cut(s) 25, 73, 88, 118, 130, 136, 142
SseBI AGGCCT 1 cut(s) 64
StuI AGGCCT 1 cut(s) 64
TfiI GAWTC 2 cut(s) 79, 150
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TscAI CASTG 2 cut(s) 80, 134
TspRI CASTG 2 cut(s) 80, 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.