Rh1CG058200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0004030
Physical Location & Seq
Reverse (-)
11514644 .. 11515983
1340 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG058200.1

Sequence Viewer

Length: 330 bp
ATGGGTCATTGCTCTGAGGATGCCAACGTTGGCGGGTCTTGGTCGGATTCGCTAGGCAGTCCCTGTGGTGAATTTCATGACGGCTGCAGCAACTGGAATGGCAACGGCAATGGATTCACCGGTGGATGCAGTGGCTCCGATTCTAACCGTGGCAGTGGCTTGGAGGAATCTGCCAGGACCTCTAAAAGCTGGGCTTTTGGGGCTTCTAGCATTCCTCTAAGCATGGAACAAGGCCATGCTACGATAGCCACATCTACAAAATATGATGAAATTCATGAACTAGTCATAAAGGATAGCATAGAACATAAAGCCTTACAGCTGAAGACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

11.38

Weight (kDa)

4.98

Isoelectric Point (pI)

33.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 33
AclI AACGTT 1 cut(s) 27
AcsI RAATTY 2 cut(s) 71, 270
AgeI ACCGGT 1 cut(s) 119
AhlI ACTAGT 1 cut(s) 280
AjnI CCWGG 1 cut(s) 173
AluBI AGCT 2 cut(s) 189, 319
AluI AGCT 2 cut(s) 189, 319
AlwNI CAGNNNCTG 2 cut(s) 63, 93
AoxI GGCC 1 cut(s) 232
ApeKI GCWGC 2 cut(s) 84, 87
ApoI RAATTY 2 cut(s) 71, 270
AsiGI ACCGGT 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 177
AsuHPI GGTGA 2 cut(s) 80, 109
AvaII GGWCC 1 cut(s) 177
BbvI GCAGC 2 cut(s) 71, 99
BceAI ACGGC 2 cut(s) 97, 121
BciT130I CCWGG 1 cut(s) 175
BcuI ACTAGT 1 cut(s) 280
BfaI CTAG 3 cut(s) 53, 207, 281
BfmI CTRYAG 1 cut(s) 85
BisI GCNGC 2 cut(s) 85, 88
BlsI GCNGC 2 cut(s) 86, 89
Bme1390I CCNGG 1 cut(s) 175
Bme18I GGWCC 1 cut(s) 177
BmgT120I GGNCC 1 cut(s) 177
BmiI GGNNCC 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 175
BmsI GCATC 2 cut(s) 10, 116
BsaJI CCNNGG 1 cut(s) 148
BsaWI WCCGGW 1 cut(s) 119
Bse118I RCCGGY 1 cut(s) 119
Bse1I ACTGG 1 cut(s) 98
Bse3DI GCAATG 2 cut(s) 7, 115
BseBI CCWGG 1 cut(s) 175
BseDI CCNNGG 1 cut(s) 148
BseGI GGATG 2 cut(s) 25, 131
BseMI GCAATG 2 cut(s) 7, 115
BseMII CTCAG 1 cut(s) 6
BseNI ACTGG 1 cut(s) 98
BseXI GCAGC 2 cut(s) 71, 99
BseYI CCCAGC 1 cut(s) 189
BshFI GGCC 1 cut(s) 234
BshTI ACCGGT 1 cut(s) 119
BsiSI CCGG 1 cut(s) 120
BslFI GGGAC 1 cut(s) 45
BsmFI GGGAC 1 cut(s) 45
BsmI GAATGC 1 cut(s) 210
BsnI GGCC 1 cut(s) 234
BspACI CCGC 1 cut(s) 33
BspANI GGCC 1 cut(s) 234
BspCNI CTCAG 1 cut(s) 7
BspHI TCATGA 2 cut(s) 76, 274
BspLI GGNNCC 1 cut(s) 136
BspMAI CTGCAG 1 cut(s) 89
BsrDI GCAATG 2 cut(s) 7, 115
BsrFI RCCGGY 1 cut(s) 119
BsrI ACTGG 1 cut(s) 98
BssAI RCCGGY 1 cut(s) 119
BssECI CCNNGG 1 cut(s) 148
Bst2UI CCWGG 1 cut(s) 175
Bst4CI ACNGT 1 cut(s) 149
BstDEI CTNAG 2 cut(s) 15, 218
BstDSI CCRYGG 1 cut(s) 148
BstF5I GGATG 2 cut(s) 25, 131
BstMWI GCNNNNNNNGC 2 cut(s) 200, 245
BstNI CCWGG 1 cut(s) 175
BstSCI CCNGG 1 cut(s) 173
BstSFI CTRYAG 1 cut(s) 85
BstV1I GCAGC 2 cut(s) 71, 99
BsuRI GGCC 1 cut(s) 234
BtgI CCRYGG 1 cut(s) 148
BtsCI GGATG 2 cut(s) 25, 131
BtsI GCAGTG 2 cut(s) 136, 160
BtsIMutI CAGTG 2 cut(s) 136, 160
CaiI CAGNNNCTG 2 cut(s) 63, 93
CciI TCATGA 2 cut(s) 76, 274
Cfr10I RCCGGY 1 cut(s) 119
Cfr13I GGNCC 1 cut(s) 177
CspAI ACCGGT 1 cut(s) 119
CviAII CATG 5 cut(s) 77, 223, 236, 275, 327
DdeI CTNAG 2 cut(s) 15, 218
Eco47I GGWCC 1 cut(s) 177
EcoO109I RGGNCCY 1 cut(s) 177
EcoRII CCWGG 1 cut(s) 173
FaeI CATG 5 cut(s) 80, 226, 239, 278, 330
FaiI YATR 9 cut(s) 78, 224, 237, 264, 276, 287, 299, 306, 328
FalI AAGNNNNNCTT 2 cut(s) 178, 210
FaqI GGGAC 1 cut(s) 45
FatI CATG 5 cut(s) 76, 222, 235, 274, 326
FauI CCCGC 1 cut(s) 26
Fnu4HI GCNGC 2 cut(s) 85, 88
FokI GGATG 2 cut(s) 32, 138
Fsp4HI GCNGC 2 cut(s) 85, 88
FspBI CTAG 3 cut(s) 53, 207, 281
GluI GCNGC 2 cut(s) 85, 88
GsaI CCCAGC 1 cut(s) 193
HaeIII GGCC 1 cut(s) 234
HapII CCGG 1 cut(s) 120
Hin1II CATG 5 cut(s) 80, 226, 239, 278, 330
HinfI GANTC 4 cut(s) 47, 114, 140, 167
HpaII CCGG 1 cut(s) 120
HphI GGTGA 2 cut(s) 80, 109
Hpy188I TCNGA 3 cut(s) 16, 46, 139
Hpy188III TCNNGA 2 cut(s) 77, 275
HpyCH4III ACNGT 1 cut(s) 149
HpyCH4IV ACGT 1 cut(s) 27
HpyCH4V TGCA 2 cut(s) 87, 129
HpyF10VI GCNNNNNNNGC 2 cut(s) 200, 245
HpyF3I CTNAG 2 cut(s) 15, 218
HpySE526I ACGT 1 cut(s) 27
Hsp92II CATG 5 cut(s) 80, 226, 239, 278, 330
LmnI GCTCC 1 cut(s) 140
LpnPI CCDG 6 cut(s) 76, 79, 133, 160, 175, 187
Lsp1109I GCAGC 2 cut(s) 71, 99
LweI GCATC 2 cut(s) 10, 116
MaeI CTAG 3 cut(s) 53, 207, 281
MaeII ACGT 1 cut(s) 27
MluCI AATT 2 cut(s) 71, 270
MmeI TCCRAC 1 cut(s) 24
MnlI CCTC 4 cut(s) 10, 157, 190, 225
MspA1I CMGCKG 1 cut(s) 319
MspI CCGG 1 cut(s) 120
MspR9I CCNGG 1 cut(s) 175
Mva1269I GAATGC 1 cut(s) 210
MvaI CCWGG 1 cut(s) 175
MwoI GCNNNNNNNGC 2 cut(s) 200, 245
NlaIII CATG 5 cut(s) 80, 226, 239, 278, 330
NlaIV GGNNCC 1 cut(s) 136
PagI TCATGA 2 cut(s) 76, 274
PctI GAATGC 1 cut(s) 210
PfeI GAWTC 4 cut(s) 47, 114, 140, 167
PinAI ACCGGT 1 cut(s) 119
PkrI GCNGC 2 cut(s) 86, 89
PpuMI RGGWCCY 1 cut(s) 177
Psp1406I AACGTT 1 cut(s) 27
Psp5II RGGWCCY 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 173
PspFI CCCAGC 1 cut(s) 189
PspGI CCWGG 1 cut(s) 173
PspN4I GGNNCC 1 cut(s) 136
PspPI GGNCC 1 cut(s) 177
PspPPI RGGWCCY 1 cut(s) 177
PstI CTGCAG 1 cut(s) 89
PstNI CAGNNNCTG 2 cut(s) 63, 93
PvuII CAGCTG 1 cut(s) 319
SatI GCNGC 2 cut(s) 85, 88
Sau96I GGNCC 1 cut(s) 177
ScrFI CCNGG 1 cut(s) 175
SetI ASST 4 cut(s) 30, 182, 191, 321
SfaNI GCATC 2 cut(s) 10, 116
SfcI CTRYAG 1 cut(s) 85
SgrAI CRCCGGYG 1 cut(s) 119
SinI GGWCC 1 cut(s) 177
SpeI ACTAGT 1 cut(s) 280
Sse9I AATT 2 cut(s) 71, 270
SsiI CCGC 1 cut(s) 33
SspMI CTAG 3 cut(s) 53, 207, 281
StyD4I CCNGG 1 cut(s) 173
TaaI ACNGT 1 cut(s) 149
TaiI ACGT 1 cut(s) 30
TasI AATT 2 cut(s) 71, 270
TfiI GAWTC 4 cut(s) 47, 114, 140, 167
TscAI CASTG 2 cut(s) 136, 160
TseI GCWGC 2 cut(s) 84, 87
TspDTI ATGAA 4 cut(s) 65, 263, 282, 291
TspRI CASTG 2 cut(s) 136, 160
VpaK11BI GGWCC 1 cut(s) 177
XapI RAATTY 2 cut(s) 71, 270
XspI CTAG 3 cut(s) 53, 207, 281
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.