FvH4_2g10310

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Reverse (-)
9141549 .. 9149349
7801 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g10310.t1

Sequence Viewer

Length: 588 bp
ATGGAAAATAAGGAAGGCGAAGACGGCTTGCCTCAAAACCCTAATCCTAACCCTAATCAGACCCGAGGTTCAACAAAGGGAAGATCCTGCAAGGGCTGCCTCTATTACTCTTCTGTACAGAAATCCAAATCCAAGTACCCAACTTGCGTTGGCTTCTACAGAACTCTCAATCAAGTGCCCAGCTACATTGTGGGAGAAACGGAGTTGGAAGCTTCAAAAGCCGATCGCAACCTTACGGATTTTAAGTATGGCTGCGTAGGTTACTCGGTGTTCTTAGACAGGAAAGATTCAAATGATCCACATAATAAACAAGCGGAATTGCCATTTTGTGTTGGTCTTGAGGTATTATATGACAAAAGACCCGCTGGCCAGGCTCATTCTCCTGCTCCTGCTCGTAAAAGTGAAGACAATGTTCGACCTATTCCTCAACCTCAAAGCTACAAACCACATTCAACTGGAGATGAGTACCTGACCAGGTTTAAGAGGAATGCTGGCCTAGTAGCATCAGGCGTTGCTAGAAATTTGAACAGGGTAGGCAACCATATAAAACAGAGCGTGGATAGCATCTTATTTGGAAGGTCCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

196

Amino Acids

21.67

Weight (kDa)

9.33

Isoelectric Point (pI)

48.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF8204 PF26631 26 - 116 4.8e-42 Domain of unknown function (DUF8204)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 314, 363
AclWI GGATC 2 cut(s) 78, 290
AcoI YGGCCR 1 cut(s) 367
AcsI RAATTY 1 cut(s) 520
AfaI GTAC 3 cut(s) 117, 137, 467
AgsI TTSAA 5 cut(s) 72, 216, 291, 453, 526
AjnI CCWGG 2 cut(s) 369, 473
AluBI AGCT 3 cut(s) 183, 212, 438
AluI AGCT 3 cut(s) 183, 212, 438
AlwI GGATC 2 cut(s) 78, 290
Ama87I CYCGRG 1 cut(s) 63
AoxI GGCC 2 cut(s) 367, 493
ApeKI GCWGC 2 cut(s) 96, 252
ApoI RAATTY 1 cut(s) 520
AspS9I GGNCC 1 cut(s) 579
AvaI CYCGRG 1 cut(s) 63
AvaII GGWCC 1 cut(s) 579
BaeGI GKGCMC 1 cut(s) 180
BalI TGGCCA 1 cut(s) 369
BbsI GAAGAC 2 cut(s) 27, 411
BbvI GCAGC 2 cut(s) 83, 239
BceAI ACGGC 1 cut(s) 40
BciT130I CCWGG 2 cut(s) 371, 475
BfaI CTAG 2 cut(s) 497, 516
BfmI CTRYAG 1 cut(s) 157
BisI GCNGC 2 cut(s) 97, 253
BlsI GCNGC 2 cut(s) 98, 254
Bme1390I CCNGG 2 cut(s) 371, 475
Bme18I GGWCC 1 cut(s) 579
BmeT110I CYCGRG 1 cut(s) 63
BmgT120I GGNCC 1 cut(s) 579
BmrFI CCNGG 2 cut(s) 371, 475
BmsI GCATC 2 cut(s) 512, 573
BpiI GAAGAC 2 cut(s) 27, 411
BpmI CTGGAG 1 cut(s) 477
BpuEI CTTGAG 1 cut(s) 359
BsaJI CCNNGG 1 cut(s) 64
Bse1I ACTGG 1 cut(s) 460
BseBI CCWGG 2 cut(s) 371, 475
BseDI CCNNGG 1 cut(s) 64
BseNI ACTGG 1 cut(s) 460
BseSI GKGCMC 1 cut(s) 180
BseXI GCAGC 2 cut(s) 83, 239
BseYI CCCAGC 1 cut(s) 179
Bsh1285I CGRYCG 1 cut(s) 226
BshFI GGCC 2 cut(s) 369, 495
BsiEI CGRYCG 1 cut(s) 226
BsiHKCI CYCGRG 1 cut(s) 63
BsmI GAATGC 1 cut(s) 493
BsnI GGCC 2 cut(s) 369, 495
BsoBI CYCGRG 1 cut(s) 63
Bsp1286I GDGCHC 1 cut(s) 180
Bsp1407I TGTACA 1 cut(s) 115
Bsp143I GATC 3 cut(s) 83, 223, 295
BspACI CCGC 2 cut(s) 314, 363
BspANI GGCC 2 cut(s) 369, 495
BspPI GGATC 2 cut(s) 78, 290
BsrGI TGTACA 1 cut(s) 115
BsrI ACTGG 1 cut(s) 460
BssECI CCNNGG 1 cut(s) 64
BssMI GATC 3 cut(s) 83, 223, 295
Bst2UI CCWGG 2 cut(s) 371, 475
Bst6I CTCTTC 1 cut(s) 115
BstAPI GCANNNNNTGC 1 cut(s) 96
BstAUI TGTACA 1 cut(s) 115
BstC8I GCNNGC 3 cut(s) 29, 367, 493
BstDEI CTNAG 1 cut(s) 274
BstKTI GATC 3 cut(s) 86, 226, 298
BstMBI GATC 3 cut(s) 83, 223, 295
BstMCI CGRYCG 1 cut(s) 226
BstMWI GCNNNNNNNGC 5 cut(s) 24, 96, 218, 371, 561
BstNI CCWGG 2 cut(s) 371, 475
BstSCI CCNGG 2 cut(s) 369, 473
BstSFI CTRYAG 1 cut(s) 157
BstSLI GKGCMC 1 cut(s) 180
BstV1I GCAGC 2 cut(s) 83, 239
BstV2I GAAGAC 2 cut(s) 27, 411
BstX2I RGATCY 1 cut(s) 83
BstYI RGATCY 1 cut(s) 83
BsuRI GGCC 2 cut(s) 369, 495
Cac8I GCNNGC 3 cut(s) 29, 367, 493
Cfr13I GGNCC 1 cut(s) 579
CsiI ACCWGGT 1 cut(s) 473
Csp6I GTAC 3 cut(s) 116, 136, 466
CviQI GTAC 3 cut(s) 116, 136, 466
DdeI CTNAG 1 cut(s) 274
DpnI GATC 3 cut(s) 85, 225, 297
DpnII GATC 3 cut(s) 83, 223, 295
EaeI YGGCCR 1 cut(s) 367
Eam1104I CTCTTC 1 cut(s) 115
EarI CTCTTC 1 cut(s) 115
Eco47I GGWCC 1 cut(s) 579
Eco88I CYCGRG 1 cut(s) 63
EcoRII CCWGG 2 cut(s) 369, 473
FaiI YATR 6 cut(s) 249, 303, 349, 351, 543, 545
FauI CCCGC 1 cut(s) 370
Fnu4HI GCNGC 2 cut(s) 97, 253
Fsp4HI GCNGC 2 cut(s) 97, 253
FspBI CTAG 2 cut(s) 497, 516
GluI GCNGC 2 cut(s) 97, 253
GsaI CCCAGC 1 cut(s) 183
GsuI CTGGAG 1 cut(s) 477
HaeIII GGCC 2 cut(s) 369, 495
HindIII AAGCTT 1 cut(s) 210
HinfI GANTC 1 cut(s) 287
Hpy188I TCNGA 1 cut(s) 60
Hpy188III TCNNGA 1 cut(s) 338
HpyAV CCTTC 2 cut(s) 8, 570
HpyCH4V TGCA 1 cut(s) 90
HpyF10VI GCNNNNNNNGC 5 cut(s) 24, 96, 218, 371, 561
HpyF3I CTNAG 1 cut(s) 274
Kzo9I GATC 3 cut(s) 83, 223, 295
LmnI GCTCC 1 cut(s) 391
Lsp1109I GCAGC 2 cut(s) 83, 239
LweI GCATC 2 cut(s) 512, 573
MabI ACCWGGT 1 cut(s) 473
MaeI CTAG 2 cut(s) 497, 516
MaeIII GTNAC 1 cut(s) 260
MalI GATC 3 cut(s) 85, 225, 297
MboI GATC 3 cut(s) 83, 223, 295
MboII GAAGA 4 cut(s) 32, 93, 102, 416
MflI RGATCY 1 cut(s) 83
MhlI GDGCHC 1 cut(s) 180
MlsI TGGCCA 1 cut(s) 369
MluCI AATT 2 cut(s) 317, 520
MluNI TGGCCA 1 cut(s) 369
MmeI TCCRAC 1 cut(s) 186
MnlI CCTC 7 cut(s) 42, 59, 110, 334, 435, 441, 477
Mox20I TGGCCA 1 cut(s) 369
MscI TGGCCA 1 cut(s) 369
MseI TTAA 2 cut(s) 243, 480
Msp20I TGGCCA 1 cut(s) 369
MspA1I CMGCKG 1 cut(s) 365
MspR9I CCNGG 2 cut(s) 371, 475
Mva1269I GAATGC 1 cut(s) 493
MvaI CCWGG 2 cut(s) 371, 475
MwoI GCNNNNNNNGC 5 cut(s) 24, 96, 218, 371, 561
NdeII GATC 3 cut(s) 83, 223, 295
PctI GAATGC 1 cut(s) 493
PfeI GAWTC 1 cut(s) 287
PkrI GCNGC 2 cut(s) 98, 254
Ple19I CGATCG 1 cut(s) 226
Psp6I CCWGG 2 cut(s) 369, 473
PspFI CCCAGC 1 cut(s) 179
PspGI CCWGG 2 cut(s) 369, 473
PspPI GGNCC 1 cut(s) 579
PsuI RGATCY 1 cut(s) 83
PvuI CGATCG 1 cut(s) 226
RsaI GTAC 3 cut(s) 117, 137, 467
RsaNI GTAC 3 cut(s) 116, 136, 466
SaqAI TTAA 2 cut(s) 243, 480
SatI GCNGC 2 cut(s) 97, 253
Sau3AI GATC 3 cut(s) 83, 223, 295
Sau96I GGNCC 1 cut(s) 579
ScrFI CCNGG 2 cut(s) 371, 475
SduI GDGCHC 1 cut(s) 180
SexAI ACCWGGT 1 cut(s) 473
SfaNI GCATC 2 cut(s) 512, 573
SfcI CTRYAG 1 cut(s) 157
SinI GGWCC 1 cut(s) 579
SmlI CTYRAG 1 cut(s) 338
SmoI CTYRAG 1 cut(s) 338
Sse9I AATT 2 cut(s) 317, 520
SsiI CCGC 2 cut(s) 314, 363
SspMI CTAG 2 cut(s) 497, 516
StyD4I CCNGG 2 cut(s) 369, 473
TaqI TCGA 1 cut(s) 415
TasI AATT 2 cut(s) 317, 520
TatI WGTACW 1 cut(s) 115
TfiI GAWTC 1 cut(s) 287
Tru1I TTAA 2 cut(s) 243, 480
Tru9I TTAA 2 cut(s) 243, 480
TseI GCWGC 2 cut(s) 96, 252
TspGWI ACGGA 2 cut(s) 215, 251
VpaK11BI GGWCC 1 cut(s) 579
XapI RAATTY 1 cut(s) 520
XcmI CCANNNNNNNNNTGG 1 cut(s) 187
XspI CTAG 2 cut(s) 497, 516
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.