Rh2AG133200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0003134
Physical Location & Seq
Forward (+)
12030192 .. 12032886
2695 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG133200.1

Sequence Viewer

Length: 315 bp
ATGAATCACCTACAGTTTTTGGTTGGCAAAAAAGCTCATACTAGTGCAGCTGCTGTCGCTCCTACTGCAGCTCATGCTCTCAACAAAGACGATGCTCGCGAAGTCCGTCAACCTCAGAGACCTAAACCCATTCAATCTGCAGGGAGTGATTTCTTGACCAGGCAAGCATATAATTCGAGTATTCAACTCATTAAGTTTTCAAGAAATGCAGATCTTGTCGCATCAGGGGTTTGGAAGAACATGGGTAAAGTTGGGAACTACATGAAAGAAAGTGTTTCTGATATTTTGTACCCCTACAGAGGGCGACCAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.51

Weight (kDa)

10.19

Isoelectric Point (pI)

33.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 99
AfaI GTAC 1 cut(s) 290
AfiI CCNNNNNNNGG 2 cut(s) 299, 300
AgsI TTSAA 3 cut(s) 134, 185, 201
AhlI ACTAGT 1 cut(s) 41
AjnI CCWGG 1 cut(s) 158
AluBI AGCT 3 cut(s) 35, 50, 71
AluI AGCT 3 cut(s) 35, 50, 71
Alw26I GTCTC 1 cut(s) 112
AlwNI CAGNNNCTG 1 cut(s) 53
ApeKI GCWGC 3 cut(s) 47, 50, 68
BbvI GCAGC 3 cut(s) 37, 59, 80
BcgI CGANNNNNNTGC 2 cut(s) 156, 190
BciT130I CCWGG 1 cut(s) 160
BcoDI GTCTC 1 cut(s) 112
BcuI ACTAGT 1 cut(s) 41
BfaI CTAG 1 cut(s) 42
BfmI CTRYAG 4 cut(s) 11, 66, 138, 295
BglII AGATCT 1 cut(s) 211
BisI GCNGC 3 cut(s) 48, 51, 69
BlsI GCNGC 3 cut(s) 49, 52, 70
Bme1390I CCNGG 1 cut(s) 160
BmrFI CCNGG 1 cut(s) 160
BmsI GCATC 2 cut(s) 82, 230
BsaI GGTCTC 1 cut(s) 112
Bsc4I CCNNNNNNNGG 2 cut(s) 299, 300
BseBI CCWGG 1 cut(s) 160
BseLI CCNNNNNNNGG 2 cut(s) 299, 300
BseMII CTCAG 1 cut(s) 128
BseXI GCAGC 3 cut(s) 37, 59, 80
BsgI GTGCAG 1 cut(s) 66
Bsh1236I CGCG 1 cut(s) 99
BslI CCNNNNNNNGG 2 cut(s) 299, 300
BsmAI GTCTC 1 cut(s) 112
Bso31I GGTCTC 1 cut(s) 112
Bsp143I GATC 1 cut(s) 211
Bsp68I TCGCGA 1 cut(s) 99
BspCNI CTCAG 1 cut(s) 127
BspFNI CGCG 1 cut(s) 99
BspMAI CTGCAG 2 cut(s) 70, 142
BspTNI GGTCTC 1 cut(s) 112
BssMI GATC 1 cut(s) 211
Bst2UI CCWGG 1 cut(s) 160
Bst4CI ACNGT 1 cut(s) 15
BstAPI GCANNNNNTGC 1 cut(s) 74
BstC8I GCNNGC 2 cut(s) 97, 165
BstDEI CTNAG 1 cut(s) 114
BstFNI CGCG 1 cut(s) 99
BstKTI GATC 1 cut(s) 214
BstMAI GTCTC 1 cut(s) 112
BstMBI GATC 1 cut(s) 211
BstMWI GCNNNNNNNGC 3 cut(s) 56, 65, 74
BstNI CCWGG 1 cut(s) 160
BstSCI CCNGG 1 cut(s) 158
BstSFI CTRYAG 4 cut(s) 11, 66, 138, 295
BstUI CGCG 1 cut(s) 99
BstV1I GCAGC 3 cut(s) 37, 59, 80
BstX2I RGATCY 1 cut(s) 211
BstYI RGATCY 1 cut(s) 211
BtuMI TCGCGA 1 cut(s) 99
Cac8I GCNNGC 2 cut(s) 97, 165
CaiI CAGNNNCTG 1 cut(s) 53
Csp6I GTAC 1 cut(s) 289
CviAII CATG 3 cut(s) 74, 241, 262
CviJI RGCY 3 cut(s) 35, 50, 71
CviKI_1 RGCY 3 cut(s) 35, 50, 71
CviQI GTAC 1 cut(s) 289
DdeI CTNAG 1 cut(s) 114
DpnI GATC 1 cut(s) 213
DpnII GATC 1 cut(s) 211
Eco31I GGTCTC 1 cut(s) 112
EcoRII CCWGG 1 cut(s) 158
FaeI CATG 3 cut(s) 77, 244, 265
FaiI YATR 6 cut(s) 39, 75, 169, 171, 242, 263
FatI CATG 3 cut(s) 73, 240, 261
Fnu4HI GCNGC 3 cut(s) 48, 51, 69
Fsp4HI GCNGC 3 cut(s) 48, 51, 69
FspBI CTAG 1 cut(s) 42
GluI GCNGC 3 cut(s) 48, 51, 69
Hin1II CATG 3 cut(s) 77, 244, 265
HincII GTYRAC 1 cut(s) 110
HindII GTYRAC 1 cut(s) 110
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 110
Hpy188I TCNGA 2 cut(s) 117, 280
Hpy188III TCNNGA 3 cut(s) 98, 154, 201
Hpy8I GTNNAC 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 15
HpyCH4V TGCA 4 cut(s) 47, 68, 140, 209
HpyF10VI GCNNNNNNNGC 3 cut(s) 56, 65, 74
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 3 cut(s) 77, 244, 265
Kzo9I GATC 1 cut(s) 211
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 4 cut(s) 126, 145, 172, 210
Lsp1109I GCAGC 3 cut(s) 37, 59, 80
LweI GCATC 2 cut(s) 82, 230
MaeI CTAG 1 cut(s) 42
MalI GATC 1 cut(s) 213
MboI GATC 1 cut(s) 211
MboII GAAGA 1 cut(s) 247
MflI RGATCY 1 cut(s) 211
MluCI AATT 1 cut(s) 172
MnlI CCTC 2 cut(s) 123, 293
MseI TTAA 1 cut(s) 192
MslI CAYNNNNRTG 1 cut(s) 42
MspA1I CMGCKG 1 cut(s) 50
MspR9I CCNGG 1 cut(s) 160
MvaI CCWGG 1 cut(s) 160
MvnI CGCG 1 cut(s) 99
MwoI GCNNNNNNNGC 3 cut(s) 56, 65, 74
NdeII GATC 1 cut(s) 211
NlaIII CATG 3 cut(s) 77, 244, 265
NruI TCGCGA 1 cut(s) 99
PcsI WCGNNNNNNNCGW 2 cut(s) 96, 103
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 3 cut(s) 49, 52, 70
Psp6I CCWGG 1 cut(s) 158
PspGI CCWGG 1 cut(s) 158
PstI CTGCAG 2 cut(s) 70, 142
PstNI CAGNNNCTG 1 cut(s) 53
PsuI RGATCY 1 cut(s) 211
PvuII CAGCTG 1 cut(s) 50
RruI TCGCGA 1 cut(s) 99
RsaI GTAC 1 cut(s) 290
RsaNI GTAC 1 cut(s) 289
RseI CAYNNNNRTG 1 cut(s) 42
SaqAI TTAA 1 cut(s) 192
SatI GCNGC 3 cut(s) 48, 51, 69
Sau3AI GATC 1 cut(s) 211
ScrFI CCNGG 1 cut(s) 160
SetI ASST 6 cut(s) 12, 37, 52, 73, 115, 124
SfaNI GCATC 2 cut(s) 82, 230
SfcI CTRYAG 4 cut(s) 11, 66, 138, 295
SmiMI CAYNNNNRTG 1 cut(s) 42
SpeI ACTAGT 1 cut(s) 41
Sse9I AATT 1 cut(s) 172
SspMI CTAG 1 cut(s) 42
StyD4I CCNGG 1 cut(s) 158
TaaI ACNGT 1 cut(s) 15
TaqI TCGA 1 cut(s) 176
TasI AATT 1 cut(s) 172
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TseI GCWGC 3 cut(s) 47, 50, 68
TspDTI ATGAA 2 cut(s) 17, 278
TspGWI ACGGA 1 cut(s) 95
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.