FvH4_3g45180

Cotton fibre expressed protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0004345
Physical Location & Seq
Forward (+)
37553365 .. 37557460
4096 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g45180.t1

Sequence Viewer

Length: 228 bp
ATGGATGCCCCTCGAGAGGTTGCTGCGACTGGAAGCCAACGAGTGGTGCAGAAGGAAAGGGATAATACAAAGAAACAGGCGATGAGCAGAAGGATGATGGCAGCCGATGATCAAGGCGATATCAATGATATGGCTGATGCCTTCATCAAGAAGTTCAGGAACCAGCTAAAGATTCAAAGGGAAGAATCATTCAAAAGGTTTCAGGAAATGCTTGCTCGTGGAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF761

Protein Analysis

76

Amino Acids

8.72

Weight (kDa)

9.86

Isoelectric Point (pI)

39.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF761 PF05553 38 - 73 6.2e-17 Cotton fibre expressed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 43
AfiI CCNNNNNNNGG 2 cut(s) 16, 43
AgsI TTSAA 2 cut(s) 176, 193
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
Ama87I CYCGRG 1 cut(s) 12
ApeKI GCWGC 2 cut(s) 23, 101
AvaI CYCGRG 1 cut(s) 12
BauI CACGAG 1 cut(s) 216
BbvI GCAGC 2 cut(s) 10, 113
BccI CCATC 1 cut(s) 91
BclI TGATCA 1 cut(s) 109
BisI GCNGC 2 cut(s) 24, 102
BlsI GCNGC 2 cut(s) 25, 103
BmeT110I CYCGRG 1 cut(s) 12
BmiI GGNNCC 1 cut(s) 161
BmsI GCATC 1 cut(s) 127
Bsc4I CCNNNNNNNGG 2 cut(s) 16, 43
Bse1I ACTGG 1 cut(s) 34
BseGI GGATG 2 cut(s) 10, 99
BseLI CCNNNNNNNGG 2 cut(s) 16, 43
BseNI ACTGG 1 cut(s) 34
BseXI GCAGC 2 cut(s) 10, 113
BsgI GTGCAG 1 cut(s) 68
BsiHKCI CYCGRG 1 cut(s) 12
BslI CCNNNNNNNGG 2 cut(s) 16, 43
BsoBI CYCGRG 1 cut(s) 12
Bsp143I GATC 1 cut(s) 109
BspLI GGNNCC 1 cut(s) 161
BsrI ACTGG 1 cut(s) 34
BssMI GATC 1 cut(s) 109
BssSI CACGAG 1 cut(s) 216
Bst2BI CACGAG 1 cut(s) 216
BstC8I GCNNGC 1 cut(s) 213
BstF5I GGATG 2 cut(s) 10, 99
BstKTI GATC 1 cut(s) 112
BstMBI GATC 1 cut(s) 109
BstV1I GCAGC 2 cut(s) 10, 113
BtgZI GCGATG 1 cut(s) 95
BtsCI GGATG 2 cut(s) 10, 99
Cac8I GCNNGC 1 cut(s) 213
CviJI RGCY 4 cut(s) 36, 104, 134, 166
CviKI_1 RGCY 4 cut(s) 36, 104, 134, 166
DpnI GATC 1 cut(s) 111
DpnII GATC 1 cut(s) 109
Eco32I GATATC 1 cut(s) 121
Eco88I CYCGRG 1 cut(s) 12
EcoRV GATATC 1 cut(s) 121
FaiI YATR 1 cut(s) 131
FbaI TGATCA 1 cut(s) 109
Fnu4HI GCNGC 2 cut(s) 24, 102
FokI GGATG 2 cut(s) 17, 106
Fsp4HI GCNGC 2 cut(s) 24, 102
GluI GCNGC 2 cut(s) 24, 102
HinfI GANTC 2 cut(s) 172, 185
Hpy188III TCNNGA 4 cut(s) 14, 148, 157, 203
HpyAV CCTTC 3 cut(s) 46, 84, 151
HpyCH4V TGCA 1 cut(s) 49
Ksp22I TGATCA 1 cut(s) 109
Kzo9I GATC 1 cut(s) 109
LpnPI CCDG 5 cut(s) 15, 62, 142, 176, 188
Lsp1109I GCAGC 2 cut(s) 10, 113
LweI GCATC 1 cut(s) 127
MalI GATC 1 cut(s) 111
MboI GATC 1 cut(s) 109
MboII GAAGA 1 cut(s) 194
MnlI CCTC 2 cut(s) 10, 21
MseI TTAA 1 cut(s) 226
NdeII GATC 1 cut(s) 109
NlaIV GGNNCC 1 cut(s) 161
PaeR7I CTCGAG 1 cut(s) 12
PfeI GAWTC 2 cut(s) 172, 185
PflMI CCANNNNNTGG 1 cut(s) 43
PkrI GCNGC 2 cut(s) 25, 103
PspN4I GGNNCC 1 cut(s) 161
SaqAI TTAA 1 cut(s) 226
SatI GCNGC 2 cut(s) 24, 102
Sau3AI GATC 1 cut(s) 109
SetI ASST 3 cut(s) 21, 168, 200
SfaNI GCATC 1 cut(s) 127
Sfr274I CTCGAG 1 cut(s) 12
SlaI CTCGAG 1 cut(s) 12
SmlI CTYRAG 1 cut(s) 12
SmoI CTYRAG 1 cut(s) 12
TaqI TCGA 1 cut(s) 13
TfiI GAWTC 2 cut(s) 172, 185
Tru1I TTAA 1 cut(s) 226
Tru9I TTAA 1 cut(s) 226
TseI GCWGC 2 cut(s) 23, 101
TspDTI ATGAA 1 cut(s) 133
Van91I CCANNNNNTGG 1 cut(s) 43
XhoI CTCGAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.