Rw5G049590

Cotton fibre expressed protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0004345
Physical Location & Seq
Reverse (-)
86077974 .. 86078204
231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G049590.1

Sequence Viewer

Length: 231 bp
ATGGATGCTCGTCGAGAGGTTGCTGCGAGTGGAAGCCAACGAGTGCAGAAGGAAAAGGATATCGATAATACAAAGAAACAGGCAATGAGCAGAAGGATGATGGCAGCGGATGAGCAAGGCGACATTAATGATATGGCTGATGCCTTCATCAAGAAGTTCAGGAAGCAGCTAAAGATTCAAAGGGAAGAATCATTCAAAAGGTTTCAGGAAATGATTGCTCGTGGGGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF761

Protein Analysis

76

Amino Acids

8.9

Weight (kDa)

9.89

Isoelectric Point (pI)

51.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF761 PF05553 39 - 74 1.1e-16 Cotton fibre expressed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 107
AgsI TTSAA 2 cut(s) 179, 196
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
ApeKI GCWGC 3 cut(s) 23, 104, 166
AseI ATTAAT 1 cut(s) 126
BauI CACGAG 1 cut(s) 219
BbvI GCAGC 3 cut(s) 10, 116, 178
BccI CCATC 1 cut(s) 94
BisI GCNGC 3 cut(s) 24, 105, 167
BlsI GCNGC 3 cut(s) 25, 106, 168
BmsI GCATC 1 cut(s) 130
Bsa29I ATCGAT 1 cut(s) 63
Bse3DI GCAATG 1 cut(s) 90
BseCI ATCGAT 1 cut(s) 63
BseGI GGATG 3 cut(s) 10, 102, 115
BseMI GCAATG 1 cut(s) 90
BseXI GCAGC 3 cut(s) 10, 116, 178
BsgI GTGCAG 1 cut(s) 65
BshVI ATCGAT 1 cut(s) 63
BspACI CCGC 1 cut(s) 107
BspDI ATCGAT 1 cut(s) 63
BsrDI GCAATG 1 cut(s) 90
BssSI CACGAG 1 cut(s) 219
Bst2BI CACGAG 1 cut(s) 219
BstF5I GGATG 3 cut(s) 10, 102, 115
BstV1I GCAGC 3 cut(s) 10, 116, 178
Bsu15I ATCGAT 1 cut(s) 63
BsuTUI ATCGAT 1 cut(s) 63
BtsCI GGATG 3 cut(s) 10, 102, 115
ClaI ATCGAT 1 cut(s) 63
CviJI RGCY 3 cut(s) 36, 137, 169
CviKI_1 RGCY 3 cut(s) 36, 137, 169
Eco32I GATATC 1 cut(s) 61
EcoRV GATATC 1 cut(s) 61
FaiI YATR 1 cut(s) 134
Fnu4HI GCNGC 3 cut(s) 24, 105, 167
FokI GGATG 3 cut(s) 17, 109, 122
Fsp4HI GCNGC 3 cut(s) 24, 105, 167
GluI GCNGC 3 cut(s) 24, 105, 167
HinfI GANTC 2 cut(s) 175, 188
Hpy188III TCNNGA 4 cut(s) 14, 151, 160, 206
Hpy99I CGWCG 1 cut(s) 15
HpyAV CCTTC 3 cut(s) 43, 87, 154
HpyCH4V TGCA 1 cut(s) 46
LpnPI CCDG 3 cut(s) 65, 145, 191
Lsp1109I GCAGC 3 cut(s) 10, 116, 178
LweI GCATC 1 cut(s) 130
MboII GAAGA 1 cut(s) 197
MnlI CCTC 1 cut(s) 10
MseI TTAA 2 cut(s) 126, 229
MspA1I CMGCKG 1 cut(s) 107
PfeI GAWTC 2 cut(s) 175, 188
PkrI GCNGC 3 cut(s) 25, 106, 168
PshBI ATTAAT 1 cut(s) 126
SaqAI TTAA 2 cut(s) 126, 229
SatI GCNGC 3 cut(s) 24, 105, 167
SetI ASST 3 cut(s) 21, 171, 203
SfaNI GCATC 1 cut(s) 130
SgeI CNNG 9 cut(s) 21, 26, 39, 53, 92, 128, 163, 172, 218
SsiI CCGC 1 cut(s) 107
TaqI TCGA 2 cut(s) 13, 63
TfiI GAWTC 2 cut(s) 175, 188
Tru1I TTAA 2 cut(s) 126, 229
Tru9I TTAA 2 cut(s) 126, 229
TseI GCWGC 3 cut(s) 23, 104, 166
TspDTI ATGAA 1 cut(s) 136
VspI ATTAAT 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.