Rh5CG579800

Cotton fibre expressed protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0004345
Physical Location & Seq
Forward (+)
82424074 .. 82430199
6126 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG579800.1

Sequence Viewer

Length: 378 bp
ATGCATGCTGGTGTGAATAAAATTTCACTTCTAAGTGTAGCTGTTGGATTACCGACAACACAGGGATTTCGAGGCACATTTCTCTCCAACCCCCTCATTCAATCCAACATCAAGAAATCTTTGAGCTATCTTACCAAAGTGGCTGTCATGGATGCTCGTCGAGAGGTTGCTGCGAGTGGAAGCCAACGAGTGCAGAAGGAAAAGGATATCGATTATACAAAGAAACAGGCAATGAGCAGAAGGATGATGGCAGCGGATGAGCAAGGCGACATTAATGATATGGCTGATGCCTTCATCAAGAAGTTCAGGAAGCAGCTAAAGATTCAAAGGGAAGAATCATTCAAAAGGTTTCAGGAAATGATTGCTCGTGGGGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF761

Protein Analysis

125

Amino Acids

14.13

Weight (kDa)

10.16

Isoelectric Point (pI)

46.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF761 PF05553 88 - 123 3.2e-16 Cotton fibre expressed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 254
AcsI RAATTY 1 cut(s) 21
AgsI TTSAA 3 cut(s) 101, 326, 343
AluBI AGCT 3 cut(s) 41, 126, 316
AluI AGCT 3 cut(s) 41, 126, 316
ApeKI GCWGC 3 cut(s) 170, 251, 313
ApoI RAATTY 1 cut(s) 21
ArsI GACNNNNNNTTYG 2 cut(s) 129, 161
AseI ATTAAT 1 cut(s) 273
BauI CACGAG 1 cut(s) 366
BbvI GCAGC 3 cut(s) 157, 263, 325
BccI CCATC 1 cut(s) 241
BisI GCNGC 3 cut(s) 171, 252, 314
BlsI GCNGC 3 cut(s) 172, 253, 315
BmsI GCATC 2 cut(s) 142, 277
Bsa29I ATCGAT 1 cut(s) 210
Bse3DI GCAATG 1 cut(s) 237
BseCI ATCGAT 1 cut(s) 210
BseGI GGATG 3 cut(s) 157, 249, 262
BseMI GCAATG 1 cut(s) 237
BseXI GCAGC 3 cut(s) 157, 263, 325
BsgI GTGCAG 1 cut(s) 212
BshVI ATCGAT 1 cut(s) 210
BspACI CCGC 1 cut(s) 254
BspDI ATCGAT 1 cut(s) 210
BsrDI GCAATG 1 cut(s) 237
BssSI CACGAG 1 cut(s) 366
Bst2BI CACGAG 1 cut(s) 366
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 32
BstF5I GGATG 3 cut(s) 157, 249, 262
BstNSI RCATGY 1 cut(s) 8
BstV1I GCAGC 3 cut(s) 157, 263, 325
Bsu15I ATCGAT 1 cut(s) 210
BsuTUI ATCGAT 1 cut(s) 210
BtsCI GGATG 3 cut(s) 157, 249, 262
Cac8I GCNNGC 1 cut(s) 6
ClaI ATCGAT 1 cut(s) 210
CviAII CATG 2 cut(s) 5, 148
CviJI RGCY 6 cut(s) 41, 126, 143, 183, 284, 316
CviKI_1 RGCY 6 cut(s) 41, 126, 143, 183, 284, 316
DdeI CTNAG 1 cut(s) 32
Eco32I GATATC 1 cut(s) 208
EcoRV GATATC 1 cut(s) 208
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 8, 151
FaiI YATR 4 cut(s) 6, 149, 216, 281
FatI CATG 2 cut(s) 4, 147
Fnu4HI GCNGC 3 cut(s) 171, 252, 314
FokI GGATG 3 cut(s) 164, 256, 269
Fsp4HI GCNGC 3 cut(s) 171, 252, 314
GluI GCNGC 3 cut(s) 171, 252, 314
Hin1II CATG 2 cut(s) 8, 151
HinfI GANTC 2 cut(s) 322, 335
Hpy188III TCNNGA 5 cut(s) 112, 161, 298, 307, 353
Hpy99I CGWCG 1 cut(s) 162
HpyAV CCTTC 3 cut(s) 190, 234, 301
HpyCH4V TGCA 2 cut(s) 4, 193
HpyF3I CTNAG 1 cut(s) 32
Hsp92II CATG 2 cut(s) 8, 151
LpnPI CCDG 4 cut(s) 47, 212, 292, 338
Lsp1109I GCAGC 3 cut(s) 157, 263, 325
LweI GCATC 2 cut(s) 142, 277
MboII GAAGA 1 cut(s) 344
MluCI AATT 1 cut(s) 21
MmeI TCCRAC 3 cut(s) 25, 111, 129
MnlI CCTC 3 cut(s) 65, 104, 157
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 273, 376
MslI CAYNNNNRTG 1 cut(s) 9
MspA1I CMGCKG 1 cut(s) 254
NlaIII CATG 2 cut(s) 8, 151
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 8
PaeI GCATGC 1 cut(s) 8
PfeI GAWTC 2 cut(s) 322, 335
PkrI GCNGC 3 cut(s) 172, 253, 315
PshBI ATTAAT 1 cut(s) 273
RseI CAYNNNNRTG 1 cut(s) 9
SaqAI TTAA 2 cut(s) 273, 376
SatI GCNGC 3 cut(s) 171, 252, 314
SetI ASST 5 cut(s) 43, 128, 168, 318, 350
SfaNI GCATC 2 cut(s) 142, 277
SmiMI CAYNNNNRTG 1 cut(s) 9
SphI GCATGC 1 cut(s) 8
Sse9I AATT 1 cut(s) 21
SsiI CCGC 1 cut(s) 254
TaqI TCGA 3 cut(s) 70, 160, 210
TasI AATT 1 cut(s) 21
TfiI GAWTC 2 cut(s) 322, 335
Tru1I TTAA 2 cut(s) 273, 376
Tru9I TTAA 2 cut(s) 273, 376
TseI GCWGC 3 cut(s) 170, 251, 313
TspDTI ATGAA 1 cut(s) 283
VspI ATTAAT 1 cut(s) 273
XapI RAATTY 1 cut(s) 21
XceI RCATGY 1 cut(s) 8
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.