Rh5BG557000

Cotton fibre expressed protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0004345
Physical Location & Seq
Forward (+)
88707967 .. 88708970
1004 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG557000.1

Sequence Viewer

Length: 327 bp
ATGACAACACAGGGATTTCGAGGCACATTTCTCTCCAACCCCCTCATTCAATCCAACATCAAGAAATCTTTGAGCTATCTTACCAAAGTGGCTGTCATGGATGCTCGTCGAGAGGTTGCTGCGAGTGGAAGCCAACGAGTGCAGAAGGAAAAGGATATCGATTATACAAAGAAACAGGCAATGAGCAGAAGGATGATGGCAGCGGATGAGCAAGGCGACATTAATGATATGGCTGATGCCTTCATCAAGAAGTTCAGGAAGCAGCTAAAGATTCAAAGGGAAGAATCATTCAAAAGGTTTCAGGAAATGATTGCTCGTGGGGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF761

Protein Analysis

108

Amino Acids

12.47

Weight (kDa)

10.11

Isoelectric Point (pI)

43.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF761 PF05553 71 - 106 2.4e-16 Cotton fibre expressed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 203
AgsI TTSAA 3 cut(s) 50, 275, 292
AluBI AGCT 2 cut(s) 75, 265
AluI AGCT 2 cut(s) 75, 265
ApeKI GCWGC 3 cut(s) 119, 200, 262
ArsI GACNNNNNNTTYG 2 cut(s) 78, 110
AseI ATTAAT 1 cut(s) 222
BauI CACGAG 1 cut(s) 315
BbvI GCAGC 3 cut(s) 106, 212, 274
BccI CCATC 1 cut(s) 190
BisI GCNGC 3 cut(s) 120, 201, 263
BlsI GCNGC 3 cut(s) 121, 202, 264
BmsI GCATC 2 cut(s) 91, 226
Bsa29I ATCGAT 1 cut(s) 159
Bse3DI GCAATG 1 cut(s) 186
BseCI ATCGAT 1 cut(s) 159
BseGI GGATG 3 cut(s) 106, 198, 211
BseMI GCAATG 1 cut(s) 186
BseXI GCAGC 3 cut(s) 106, 212, 274
BsgI GTGCAG 1 cut(s) 161
BshVI ATCGAT 1 cut(s) 159
BspACI CCGC 1 cut(s) 203
BspDI ATCGAT 1 cut(s) 159
BsrDI GCAATG 1 cut(s) 186
BssSI CACGAG 1 cut(s) 315
Bst2BI CACGAG 1 cut(s) 315
BstF5I GGATG 3 cut(s) 106, 198, 211
BstV1I GCAGC 3 cut(s) 106, 212, 274
Bsu15I ATCGAT 1 cut(s) 159
BsuTUI ATCGAT 1 cut(s) 159
BtsCI GGATG 3 cut(s) 106, 198, 211
ClaI ATCGAT 1 cut(s) 159
CviAII CATG 1 cut(s) 97
CviJI RGCY 5 cut(s) 75, 92, 132, 233, 265
CviKI_1 RGCY 5 cut(s) 75, 92, 132, 233, 265
Eco32I GATATC 1 cut(s) 157
EcoRV GATATC 1 cut(s) 157
FaeI CATG 1 cut(s) 100
FaiI YATR 3 cut(s) 98, 165, 230
FatI CATG 1 cut(s) 96
Fnu4HI GCNGC 3 cut(s) 120, 201, 263
FokI GGATG 3 cut(s) 113, 205, 218
Fsp4HI GCNGC 3 cut(s) 120, 201, 263
GluI GCNGC 3 cut(s) 120, 201, 263
Hin1II CATG 1 cut(s) 100
HinfI GANTC 2 cut(s) 271, 284
Hpy188III TCNNGA 5 cut(s) 61, 110, 247, 256, 302
Hpy99I CGWCG 1 cut(s) 111
HpyAV CCTTC 3 cut(s) 139, 183, 250
HpyCH4V TGCA 1 cut(s) 142
Hsp92II CATG 1 cut(s) 100
LpnPI CCDG 3 cut(s) 161, 241, 287
Lsp1109I GCAGC 3 cut(s) 106, 212, 274
LweI GCATC 2 cut(s) 91, 226
MboII GAAGA 1 cut(s) 293
MmeI TCCRAC 2 cut(s) 60, 78
MnlI CCTC 3 cut(s) 14, 53, 106
MseI TTAA 2 cut(s) 222, 325
MspA1I CMGCKG 1 cut(s) 203
NlaIII CATG 1 cut(s) 100
PfeI GAWTC 2 cut(s) 271, 284
PkrI GCNGC 3 cut(s) 121, 202, 264
PshBI ATTAAT 1 cut(s) 222
SaqAI TTAA 2 cut(s) 222, 325
SatI GCNGC 3 cut(s) 120, 201, 263
SetI ASST 4 cut(s) 77, 117, 267, 299
SfaNI GCATC 2 cut(s) 91, 226
SsiI CCGC 1 cut(s) 203
TaqI TCGA 3 cut(s) 19, 109, 159
TfiI GAWTC 2 cut(s) 271, 284
Tru1I TTAA 2 cut(s) 222, 325
Tru9I TTAA 2 cut(s) 222, 325
TseI GCWGC 3 cut(s) 119, 200, 262
TspDTI ATGAA 1 cut(s) 232
VspI ATTAAT 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.