FvH4_3g45190

Cotton fibre expressed protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0004345
Physical Location & Seq
Forward (+)
37557004 .. 37557231
228 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g45190.t1

Sequence Viewer

Length: 228 bp
ATGGATGCTCGTCGAGAGGTTGCTGCGACTGGAAGCCAACGAGTGGTGCAGAAGGAAAGGGATAATGCAAAGAAACAGGCAATGAGCAGAAGGATGATGGCAGCCGATGCTCAAGGCGACATTAATGATATGGCTGATGCCTTCATCAAGAAGTTCAGGAACCAGCTAAAGATTCAAAGGGAAGAATCATTCAAAAGGCTTCAGGAAATGCTTGCTCGTGGAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF761

Protein Analysis

76

Amino Acids

8.67

Weight (kDa)

10.34

Isoelectric Point (pI)

51.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF761 PF05553 38 - 73 4.6e-16 Cotton fibre expressed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 43
AcuI CTGAAG 1 cut(s) 185
AfiI CCNNNNNNNGG 1 cut(s) 43
AgsI TTSAA 2 cut(s) 176, 193
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
ApeKI GCWGC 2 cut(s) 23, 101
AseI ATTAAT 1 cut(s) 123
BauI CACGAG 1 cut(s) 216
BbvI GCAGC 2 cut(s) 10, 113
BccI CCATC 1 cut(s) 91
BisI GCNGC 2 cut(s) 24, 102
BlsI GCNGC 2 cut(s) 25, 103
BmiI GGNNCC 1 cut(s) 161
BmsI GCATC 2 cut(s) 97, 127
BpuEI CTTGAG 1 cut(s) 96
Bsc4I CCNNNNNNNGG 1 cut(s) 43
Bse1I ACTGG 1 cut(s) 34
Bse3DI GCAATG 1 cut(s) 87
BseGI GGATG 2 cut(s) 10, 99
BseLI CCNNNNNNNGG 1 cut(s) 43
BseMI GCAATG 1 cut(s) 87
BseNI ACTGG 1 cut(s) 34
BseXI GCAGC 2 cut(s) 10, 113
BsgI GTGCAG 1 cut(s) 68
BslI CCNNNNNNNGG 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 161
BsrDI GCAATG 1 cut(s) 87
BsrI ACTGG 1 cut(s) 34
BssSI CACGAG 1 cut(s) 216
Bst2BI CACGAG 1 cut(s) 216
BstAPI GCANNNNNTGC 1 cut(s) 107
BstC8I GCNNGC 1 cut(s) 213
BstF5I GGATG 2 cut(s) 10, 99
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstV1I GCAGC 2 cut(s) 10, 113
BtsCI GGATG 2 cut(s) 10, 99
Cac8I GCNNGC 1 cut(s) 213
CviJI RGCY 5 cut(s) 36, 104, 134, 166, 199
CviKI_1 RGCY 5 cut(s) 36, 104, 134, 166, 199
Eco57I CTGAAG 1 cut(s) 185
FaiI YATR 1 cut(s) 131
Fnu4HI GCNGC 2 cut(s) 24, 102
FokI GGATG 2 cut(s) 17, 106
Fsp4HI GCNGC 2 cut(s) 24, 102
GluI GCNGC 2 cut(s) 24, 102
HinfI GANTC 2 cut(s) 172, 185
Hpy188III TCNNGA 4 cut(s) 14, 148, 157, 203
Hpy99I CGWCG 1 cut(s) 15
HpyAV CCTTC 3 cut(s) 46, 84, 151
HpyCH4V TGCA 2 cut(s) 49, 68
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
LpnPI CCDG 5 cut(s) 15, 62, 142, 176, 188
Lsp1109I GCAGC 2 cut(s) 10, 113
LweI GCATC 2 cut(s) 97, 127
MboII GAAGA 1 cut(s) 194
MnlI CCTC 1 cut(s) 10
MseI TTAA 2 cut(s) 123, 226
MwoI GCNNNNNNNGC 1 cut(s) 107
NlaIV GGNNCC 1 cut(s) 161
PfeI GAWTC 2 cut(s) 172, 185
PflMI CCANNNNNTGG 1 cut(s) 43
PkrI GCNGC 2 cut(s) 25, 103
PshBI ATTAAT 1 cut(s) 123
PspN4I GGNNCC 1 cut(s) 161
SaqAI TTAA 2 cut(s) 123, 226
SatI GCNGC 2 cut(s) 24, 102
SetI ASST 2 cut(s) 21, 168
SfaNI GCATC 2 cut(s) 97, 127
SmlI CTYRAG 1 cut(s) 111
SmoI CTYRAG 1 cut(s) 111
TaqI TCGA 1 cut(s) 13
TfiI GAWTC 2 cut(s) 172, 185
Tru1I TTAA 2 cut(s) 123, 226
Tru9I TTAA 2 cut(s) 123, 226
TseI GCWGC 2 cut(s) 23, 101
TspDTI ATGAA 1 cut(s) 133
Van91I CCANNNNNTGG 1 cut(s) 43
VspI ATTAAT 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.