Rw5G049520

Cotton fibre expressed protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0004345
Physical Location & Seq
Reverse (-)
85916191 .. 85916415
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G049520.1

Sequence Viewer

Length: 225 bp
ATGGATGCTCGTCAAGAGGTTGCTGCGCGTGGAAGCCAACGAGTGCAGAAGGAAAAGGATAATACAAAGAAACAGGCAATGAGCAGAAGGATGATGGCAGCGGATGAGCAAGGCGACATTAATGATATGGCTGATGCCTTCATCAAGAAGTTCAGGAAGCAGCTAAAGATTCAAAGGGAAGAATCATTCAAAAGGTTTCAGGAAATGATTGCTCGTGGGGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF761

Protein Analysis

74

Amino Acids

8.71

Weight (kDa)

10.08

Isoelectric Point (pI)

48.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF761 PF05553 37 - 72 1e-16 Cotton fibre expressed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 28
AciI CCGC 1 cut(s) 101
AgsI TTSAA 2 cut(s) 173, 190
AluBI AGCT 1 cut(s) 163
AluI AGCT 1 cut(s) 163
ApeKI GCWGC 3 cut(s) 23, 98, 160
AseI ATTAAT 1 cut(s) 120
AspLEI GCGC 1 cut(s) 28
BauI CACGAG 1 cut(s) 213
BbvI GCAGC 3 cut(s) 10, 110, 172
BccI CCATC 1 cut(s) 88
BisI GCNGC 3 cut(s) 24, 99, 161
BlsI GCNGC 3 cut(s) 25, 100, 162
BmsI GCATC 1 cut(s) 124
Bse3DI GCAATG 1 cut(s) 84
BseGI GGATG 3 cut(s) 10, 96, 109
BseMI GCAATG 1 cut(s) 84
BseXI GCAGC 3 cut(s) 10, 110, 172
BsgI GTGCAG 1 cut(s) 65
Bsh1236I CGCG 1 cut(s) 28
BspACI CCGC 1 cut(s) 101
BspFNI CGCG 1 cut(s) 28
BsrDI GCAATG 1 cut(s) 84
BssSI CACGAG 1 cut(s) 213
Bst2BI CACGAG 1 cut(s) 213
BstF5I GGATG 3 cut(s) 10, 96, 109
BstFNI CGCG 1 cut(s) 28
BstHHI GCGC 1 cut(s) 28
BstUI CGCG 1 cut(s) 28
BstV1I GCAGC 3 cut(s) 10, 110, 172
BtsCI GGATG 3 cut(s) 10, 96, 109
CfoI GCGC 1 cut(s) 28
CviJI RGCY 3 cut(s) 36, 131, 163
CviKI_1 RGCY 3 cut(s) 36, 131, 163
FaiI YATR 1 cut(s) 128
Fnu4HI GCNGC 3 cut(s) 24, 99, 161
FokI GGATG 3 cut(s) 17, 103, 116
Fsp4HI GCNGC 3 cut(s) 24, 99, 161
GlaI GCGC 1 cut(s) 27
GluI GCNGC 3 cut(s) 24, 99, 161
HhaI GCGC 1 cut(s) 28
Hin6I GCGC 1 cut(s) 26
HinP1I GCGC 1 cut(s) 26
HinfI GANTC 2 cut(s) 169, 182
Hpy188III TCNNGA 4 cut(s) 14, 145, 154, 200
HpyAV CCTTC 3 cut(s) 43, 81, 148
HpyCH4V TGCA 1 cut(s) 46
HspAI GCGC 1 cut(s) 26
LpnPI CCDG 3 cut(s) 59, 139, 185
Lsp1109I GCAGC 3 cut(s) 10, 110, 172
LweI GCATC 1 cut(s) 124
MboII GAAGA 1 cut(s) 191
MnlI CCTC 1 cut(s) 10
MseI TTAA 2 cut(s) 120, 223
MspA1I CMGCKG 1 cut(s) 101
MvnI CGCG 1 cut(s) 28
PfeI GAWTC 2 cut(s) 169, 182
PkrI GCNGC 3 cut(s) 25, 100, 162
PshBI ATTAAT 1 cut(s) 120
SaqAI TTAA 2 cut(s) 120, 223
SatI GCNGC 3 cut(s) 24, 99, 161
SetI ASST 3 cut(s) 21, 165, 197
SfaNI GCATC 1 cut(s) 124
SsiI CCGC 1 cut(s) 101
TfiI GAWTC 2 cut(s) 169, 182
Tru1I TTAA 2 cut(s) 120, 223
Tru9I TTAA 2 cut(s) 120, 223
TseI GCWGC 3 cut(s) 23, 98, 160
TspDTI ATGAA 1 cut(s) 130
VspI ATTAAT 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.