Rw5G049510

Cotton fibre expressed protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0004345
Physical Location & Seq
Reverse (-)
85915137 .. 85915367
231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G049510.1

Sequence Viewer

Length: 231 bp
ATGGATGCTTGTCGAGAGGTTGCTGCGAGTGGAAACCAACCAGTGCAGATGGAAAAGGATATCGATAATACAAAGAAACAGGCAATGAGCAGAAGGATGATGGCAGCGGATGAGCAAGGCGACATTAATGATATGGCTGATGCCTTCATCAAGAAGTTCAGGAACCAGCTCAAGATTCAAAGGGAAGAATCATTCAAAAGGTTTCAGGAAATGATTGCTCGTGGGGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF761

Protein Analysis

76

Amino Acids

8.8

Weight (kDa)

7.87

Isoelectric Point (pI)

47.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF761 PF05553 39 - 74 1.5e-16 Cotton fibre expressed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 107
AgsI TTSAA 2 cut(s) 179, 196
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
ApeKI GCWGC 2 cut(s) 23, 104
AseI ATTAAT 1 cut(s) 126
BauI CACGAG 1 cut(s) 219
BbvI GCAGC 2 cut(s) 10, 116
BccI CCATC 2 cut(s) 43, 94
BisI GCNGC 2 cut(s) 24, 105
BlsI GCNGC 2 cut(s) 25, 106
BmiI GGNNCC 1 cut(s) 164
BmsI GCATC 1 cut(s) 130
BpuEI CTTGAG 1 cut(s) 155
Bsa29I ATCGAT 1 cut(s) 63
Bse1I ACTGG 1 cut(s) 41
Bse3DI GCAATG 1 cut(s) 90
BseCI ATCGAT 1 cut(s) 63
BseGI GGATG 3 cut(s) 10, 102, 115
BseMI GCAATG 1 cut(s) 90
BseNI ACTGG 1 cut(s) 41
BseXI GCAGC 2 cut(s) 10, 116
BsgI GTGCAG 1 cut(s) 65
BshVI ATCGAT 1 cut(s) 63
BspACI CCGC 1 cut(s) 107
BspDI ATCGAT 1 cut(s) 63
BspLI GGNNCC 1 cut(s) 164
BsrDI GCAATG 1 cut(s) 90
BsrI ACTGG 1 cut(s) 41
BssSI CACGAG 1 cut(s) 219
Bst2BI CACGAG 1 cut(s) 219
BstF5I GGATG 3 cut(s) 10, 102, 115
BstV1I GCAGC 2 cut(s) 10, 116
Bsu15I ATCGAT 1 cut(s) 63
BsuTUI ATCGAT 1 cut(s) 63
BtsCI GGATG 3 cut(s) 10, 102, 115
BtsIMutI CAGTG 1 cut(s) 48
ClaI ATCGAT 1 cut(s) 63
CviJI RGCY 2 cut(s) 137, 169
CviKI_1 RGCY 2 cut(s) 137, 169
Eco32I GATATC 1 cut(s) 61
EcoRV GATATC 1 cut(s) 61
FaiI YATR 1 cut(s) 134
Fnu4HI GCNGC 2 cut(s) 24, 105
FokI GGATG 3 cut(s) 17, 109, 122
Fsp4HI GCNGC 2 cut(s) 24, 105
GluI GCNGC 2 cut(s) 24, 105
HinfI GANTC 2 cut(s) 175, 188
Hpy188III TCNNGA 5 cut(s) 14, 151, 160, 172, 206
HpyAV CCTTC 2 cut(s) 87, 154
HpyCH4V TGCA 1 cut(s) 46
LpnPI CCDG 5 cut(s) 54, 65, 145, 179, 191
Lsp1109I GCAGC 2 cut(s) 10, 116
LweI GCATC 1 cut(s) 130
MboII GAAGA 1 cut(s) 197
MnlI CCTC 1 cut(s) 10
MseI TTAA 2 cut(s) 126, 229
MspA1I CMGCKG 1 cut(s) 107
NlaIV GGNNCC 1 cut(s) 164
PfeI GAWTC 2 cut(s) 175, 188
PkrI GCNGC 2 cut(s) 25, 106
PshBI ATTAAT 1 cut(s) 126
PspN4I GGNNCC 1 cut(s) 164
SaqAI TTAA 2 cut(s) 126, 229
SatI GCNGC 2 cut(s) 24, 105
SetI ASST 3 cut(s) 21, 171, 203
SfaNI GCATC 1 cut(s) 130
SmlI CTYRAG 1 cut(s) 170
SmoI CTYRAG 1 cut(s) 170
SsiI CCGC 1 cut(s) 107
TaqI TCGA 2 cut(s) 13, 63
TfiI GAWTC 2 cut(s) 175, 188
Tru1I TTAA 2 cut(s) 126, 229
Tru9I TTAA 2 cut(s) 126, 229
TscAI CASTG 1 cut(s) 48
TseI GCWGC 2 cut(s) 23, 104
TspDTI ATGAA 1 cut(s) 136
TspRI CASTG 1 cut(s) 48
VspI ATTAAT 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.