FvH4_5g06540

Auxin response factors (ARFs) are transcriptional factors that bind specifically to the DNA sequence 5'-TGTCTC-3' found in the auxin-responsive promoter elements (AuxREs)

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
3854449 .. 3854688
240 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g06540.t1

Sequence Viewer

Length: 240 bp
ATGATCTGGACACCCAATTATAGCATTCATGCGCCCCGGTCAAATATTTACGTCTCACGTCCTAGAGACAAAGTCTTCTACTTCTCTCAAGGCCACATTGAACAGGTTGAGGCATATCTAGACACAGACGCTAATTTGACCATGCCAAGATACAATTTGCCTCCTAAGATTCTTTGCTATGTTGTGAATGTTCTACTAAAGGCTGAAGTTCACACATATGAGAGGTCTTTGTCCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.3

Weight (kDa)

8.79

Isoelectric Point (pI)

53.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 225
AgsI TTSAA 1 cut(s) 101
AjiI CACGTC 1 cut(s) 59
Alw26I GTCTC 2 cut(s) 58, 60
AoxI GGCC 1 cut(s) 91
AspLEI GCGC 1 cut(s) 34
AsuC2I CCSGG 1 cut(s) 37
BbsI GAAGAC 1 cut(s) 67
BcnI CCSGG 1 cut(s) 37
BcoDI GTCTC 2 cut(s) 58, 60
BfaI CTAG 2 cut(s) 63, 119
Bme1390I CCNGG 1 cut(s) 37
BmgBI CACGTC 1 cut(s) 59
BmrFI CCNGG 1 cut(s) 37
BpiI GAAGAC 1 cut(s) 67
BpuEI CTTGAG 1 cut(s) 72
BpuMI CCSGG 1 cut(s) 37
BsaJI CCNNGG 1 cut(s) 35
BseDI CCNNGG 1 cut(s) 35
BshFI GGCC 1 cut(s) 93
BsiSI CCGG 1 cut(s) 37
BsmAI GTCTC 2 cut(s) 58, 60
BsmBI CGTCTC 1 cut(s) 58
BsmI GAATGC 1 cut(s) 24
BsnI GGCC 1 cut(s) 93
Bsp143I GATC 1 cut(s) 3
BspANI GGCC 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 35
BssMI GATC 1 cut(s) 3
BstDEI CTNAG 1 cut(s) 165
BstHHI GCGC 1 cut(s) 34
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 2 cut(s) 58, 60
BstMBI GATC 1 cut(s) 3
BstSCI CCNGG 1 cut(s) 35
BstV2I GAAGAC 1 cut(s) 67
BsuRI GGCC 1 cut(s) 93
BtrI CACGTC 1 cut(s) 59
CfoI GCGC 1 cut(s) 34
CseI GACGC 1 cut(s) 137
CviAII CATG 2 cut(s) 29, 142
CviJI RGCY 2 cut(s) 93, 203
CviKI_1 RGCY 2 cut(s) 93, 203
DdeI CTNAG 1 cut(s) 165
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco57I CTGAAG 1 cut(s) 225
Esp3I CGTCTC 1 cut(s) 58
FaeI CATG 2 cut(s) 32, 145
FaiI YATR 7 cut(s) 21, 30, 115, 143, 180, 217, 219
FatI CATG 2 cut(s) 28, 141
FauNDI CATATG 1 cut(s) 217
FspBI CTAG 2 cut(s) 63, 119
GlaI GCGC 1 cut(s) 33
HaeIII GGCC 1 cut(s) 93
HapII CCGG 1 cut(s) 37
HgaI GACGC 1 cut(s) 137
HhaI GCGC 1 cut(s) 34
Hin1II CATG 2 cut(s) 32, 145
Hin6I GCGC 1 cut(s) 32
HinP1I GCGC 1 cut(s) 32
HinfI GANTC 1 cut(s) 169
HpaII CCGG 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 211
Hpy188III TCNNGA 2 cut(s) 7, 119
Hpy8I GTNNAC 1 cut(s) 211
HpyCH4IV ACGT 2 cut(s) 51, 58
HpyF3I CTNAG 1 cut(s) 165
HpySE526I ACGT 2 cut(s) 51, 58
Hsp92II CATG 2 cut(s) 32, 145
HspAI GCGC 1 cut(s) 32
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 2 cut(s) 50, 89
MaeI CTAG 2 cut(s) 63, 119
MaeII ACGT 2 cut(s) 51, 58
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 1 cut(s) 67
MluCI AATT 3 cut(s) 16, 133, 154
MnlI CCTC 3 cut(s) 103, 171, 216
MslI CAYNNNNRTG 1 cut(s) 216
MspI CCGG 1 cut(s) 37
MspR9I CCNGG 1 cut(s) 37
Mva1269I GAATGC 1 cut(s) 24
NciI CCSGG 1 cut(s) 37
NdeI CATATG 1 cut(s) 217
NdeII GATC 1 cut(s) 3
NlaIII CATG 2 cut(s) 32, 145
PctI GAATGC 1 cut(s) 24
PfeI GAWTC 1 cut(s) 169
PflFI GACNNNGTC 1 cut(s) 71
PsyI GACNNNGTC 1 cut(s) 71
RseI CAYNNNNRTG 1 cut(s) 216
Sau3AI GATC 1 cut(s) 3
ScrFI CCNGG 1 cut(s) 37
SetI ASST 4 cut(s) 54, 61, 108, 227
SmiMI CAYNNNNRTG 1 cut(s) 216
SmlI CTYRAG 1 cut(s) 87
SmoI CTYRAG 1 cut(s) 87
Sse9I AATT 3 cut(s) 16, 133, 154
SspI AATATT 1 cut(s) 46
SspMI CTAG 2 cut(s) 63, 119
StyD4I CCNGG 1 cut(s) 35
TaiI ACGT 2 cut(s) 54, 61
TasI AATT 3 cut(s) 16, 133, 154
TfiI GAWTC 1 cut(s) 169
TspDTI ATGAA 1 cut(s) 17
Tth111I GACNNNGTC 1 cut(s) 71
XbaI TCTAGA 1 cut(s) 118
XspI CTAG 2 cut(s) 63, 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.