FvH4_6g38381

Ribosomal protein-like protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Forward (+)
30334685 .. 30335190
506 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g38381.t1

Sequence Viewer

Length: 342 bp
ATGGATTTCAATTTTTCAGATTCATCCTCAGATGCTGTAGATGACGAATTATGGAATCTTGCCGATTCATCCTTAGATGAAGAATTCAATAGGCAAATTATTGCTCTTTTAGAAGAGAACTTGGAGAATGGAAGAAGAAGACGTTGGGGTTCAATTCCAGAAAAAAGATTCAGCACGCAAAAGGTAACAACGGCAATGCGTATGCTTACTTATGGAGTTGGGGCAGATGTTGTGGATGATTATCTCCGAATTGGTGAAAGCACTGCAATTGAAGCTATGAGAAGGTTTGTGTTTGCTGTTATTAATGTGTTTGGAGTTGAATACTTGAGAAACCAAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

13.03

Weight (kDa)

4.54

Isoelectric Point (pI)

53.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 83, 336
AgsI TTSAA 5 cut(s) 10, 88, 153, 272, 320
AjuI GAANNNNNNNTTGG 2 cut(s) 127, 159
AluBI AGCT 1 cut(s) 275
AluI AGCT 1 cut(s) 275
AlwNI CAGNNNCTG 1 cut(s) 35
ApoI RAATTY 2 cut(s) 83, 336
AseI ATTAAT 1 cut(s) 303
AsuHPI GGTGA 1 cut(s) 266
BbsI GAAGAC 1 cut(s) 145
BceAI ACGGC 1 cut(s) 207
BfmI CTRYAG 1 cut(s) 36
BmsI GCATC 1 cut(s) 22
BpiI GAAGAC 1 cut(s) 145
BsaBI GATNNNNATC 1 cut(s) 240
Bse3DI GCAATG 1 cut(s) 201
Bse8I GATNNNNATC 1 cut(s) 240
BseGI GGATG 3 cut(s) 23, 68, 241
BseJI GATNNNNATC 1 cut(s) 240
BseMI GCAATG 1 cut(s) 201
BseMII CTCAG 1 cut(s) 42
BspCNI CTCAG 1 cut(s) 41
BsrDI GCAATG 1 cut(s) 201
Bst6I CTCTTC 1 cut(s) 108
BstC8I GCNNGC 1 cut(s) 176
BstDEI CTNAG 2 cut(s) 28, 73
BstF5I GGATG 3 cut(s) 23, 68, 241
BstMWI GCNNNNNNNGC 1 cut(s) 272
BstSFI CTRYAG 1 cut(s) 36
BstV2I GAAGAC 1 cut(s) 145
BtsCI GGATG 3 cut(s) 23, 68, 241
BtsI GCAGTG 1 cut(s) 261
BtsIMutI CAGTG 1 cut(s) 261
Cac8I GCNNGC 1 cut(s) 176
CaiI CAGNNNCTG 1 cut(s) 35
CviJI RGCY 1 cut(s) 275
CviKI_1 RGCY 1 cut(s) 275
DdeI CTNAG 2 cut(s) 28, 73
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
EcoRI GAATTC 1 cut(s) 83
FaiI YATR 4 cut(s) 52, 203, 213, 278
FokI GGATG 3 cut(s) 10, 55, 248
HinfI GANTC 4 cut(s) 20, 55, 65, 168
HphI GGTGA 1 cut(s) 266
Hpy188I TCNGA 3 cut(s) 19, 31, 248
Hpy188III TCNNGA 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 276
HpyCH4IV ACGT 1 cut(s) 142
HpyCH4V TGCA 1 cut(s) 266
HpyF10VI GCNNNNNNNGC 1 cut(s) 272
HpyF3I CTNAG 2 cut(s) 28, 73
HpySE526I ACGT 1 cut(s) 142
LpnPI CCDG 1 cut(s) 171
LweI GCATC 1 cut(s) 22
MaeII ACGT 1 cut(s) 142
MaeIII GTNAC 1 cut(s) 184
MboII GAAGA 5 cut(s) 92, 125, 144, 147, 150
MfeI CAATTG 1 cut(s) 267
MluCI AATT 8 cut(s) 10, 47, 83, 96, 153, 249, 267, 336
MnlI CCTC 1 cut(s) 37
MseI TTAA 1 cut(s) 303
MunI CAATTG 1 cut(s) 267
MwoI GCNNNNNNNGC 1 cut(s) 272
PfeI GAWTC 4 cut(s) 20, 55, 65, 168
PshBI ATTAAT 1 cut(s) 303
PstNI CAGNNNCTG 1 cut(s) 35
SaqAI TTAA 1 cut(s) 303
SetI ASST 4 cut(s) 145, 186, 277, 287
SfaNI GCATC 1 cut(s) 22
SfcI CTRYAG 1 cut(s) 36
SgeI CNNG 5 cut(s) 71, 133, 170, 187, 337
SmlI CTYRAG 1 cut(s) 325
SmoI CTYRAG 1 cut(s) 325
Sse9I AATT 8 cut(s) 10, 47, 83, 96, 153, 249, 267, 336
TaiI ACGT 1 cut(s) 145
TasI AATT 8 cut(s) 10, 47, 83, 96, 153, 249, 267, 336
TfiI GAWTC 4 cut(s) 20, 55, 65, 168
Tru1I TTAA 1 cut(s) 303
Tru9I TTAA 1 cut(s) 303
TscAI CASTG 1 cut(s) 268
TspDTI ATGAA 3 cut(s) 12, 57, 93
TspRI CASTG 1 cut(s) 268
VspI ATTAAT 1 cut(s) 303
XapI RAATTY 2 cut(s) 83, 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.