RchiOBHm_Chr3g0473411

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0005193
Physical Location & Seq
Reverse (-)
19271602 .. 19271995
394 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43909

Sequence Viewer

Length: 321 bp
ATGGATCAAAATTTATCAGATTCATCTTCAAATCCTGCAAATGAGGAATTTTGGGATCTTGCCAATTCATCATCAGACGAAGAATTGATGAATCTGGAGATTGCTGCTCTACAAGAGAAGGGAAGAAGAAGACGCCGAGGCTCAATTCCTGGTCGCATATATAAAGATAGACAACGATTGCAAGGTCAGGAAACACTCTACAATGATTATTTTGCTGAAAATCCTGTTCATGAAGAAGTTGTATTTCGGAGAAGGGTTCAGATGCATCGACATGTTTTTCTTCGAATTCTAGCTGCAGTTAAATGCATGTTTATCTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

106

Amino Acids

12.53

Weight (kDa)

6.83

Isoelectric Point (pI)

88.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 12, 63
AcsI RAATTY 3 cut(s) 10, 47, 285
AcyI GRCGYC 1 cut(s) 133
AflIII ACRYGT 1 cut(s) 271
AgsI TTSAA 1 cut(s) 30
AjnI CCWGG 1 cut(s) 148
AluBI AGCT 1 cut(s) 293
AluI AGCT 1 cut(s) 293
AlwI GGATC 2 cut(s) 12, 63
ApeKI GCWGC 2 cut(s) 104, 293
ApoI RAATTY 3 cut(s) 10, 47, 285
AsuII TTCGAA 1 cut(s) 283
BbsI GAAGAC 1 cut(s) 136
BbvI GCAGC 2 cut(s) 91, 280
BciT130I CCWGG 1 cut(s) 150
BfaI CTAG 1 cut(s) 290
BfmI CTRYAG 1 cut(s) 294
BisI GCNGC 2 cut(s) 105, 294
BlsI GCNGC 2 cut(s) 106, 295
Bme1390I CCNGG 1 cut(s) 150
BmrFI CCNGG 1 cut(s) 150
BmsI GCATC 2 cut(s) 252, 274
BpiI GAAGAC 1 cut(s) 136
BpmI CTGGAG 1 cut(s) 116
Bpu14I TTCGAA 1 cut(s) 283
BsaHI GRCGYC 1 cut(s) 133
BsaJI CCNNGG 1 cut(s) 136
BseBI CCWGG 1 cut(s) 150
BseDI CCNNGG 1 cut(s) 136
BseXI GCAGC 2 cut(s) 91, 280
Bsp119I TTCGAA 1 cut(s) 283
Bsp143I GATC 2 cut(s) 4, 55
BspHI TCATGA 1 cut(s) 229
BspMAI CTGCAG 1 cut(s) 298
BspPI GGATC 2 cut(s) 12, 63
BspT104I TTCGAA 1 cut(s) 283
BssECI CCNNGG 1 cut(s) 136
BssMI GATC 2 cut(s) 4, 55
BssNI GRCGYC 1 cut(s) 133
Bst2UI CCWGG 1 cut(s) 150
BstACI GRCGYC 1 cut(s) 133
BstBI TTCGAA 1 cut(s) 283
BstKTI GATC 2 cut(s) 7, 58
BstMBI GATC 2 cut(s) 4, 55
BstNI CCWGG 1 cut(s) 150
BstNSI RCATGY 2 cut(s) 275, 310
BstSCI CCNGG 1 cut(s) 148
BstSFI CTRYAG 1 cut(s) 294
BstV1I GCAGC 2 cut(s) 91, 280
BstV2I GAAGAC 1 cut(s) 136
BstX2I RGATCY 1 cut(s) 55
BstYI RGATCY 1 cut(s) 55
CciI TCATGA 1 cut(s) 229
CseI GACGC 1 cut(s) 141
CviAII CATG 3 cut(s) 230, 272, 307
CviJI RGCY 2 cut(s) 141, 293
CviKI_1 RGCY 2 cut(s) 141, 293
DpnI GATC 2 cut(s) 6, 57
DpnII GATC 2 cut(s) 4, 55
EcoRI GAATTC 1 cut(s) 285
EcoRII CCWGG 1 cut(s) 148
EcoT22I ATGCAT 2 cut(s) 267, 308
FaeI CATG 3 cut(s) 233, 275, 310
FaiI YATR 6 cut(s) 158, 160, 162, 231, 273, 308
FatI CATG 3 cut(s) 229, 271, 306
Fnu4HI GCNGC 2 cut(s) 105, 294
Fsp4HI GCNGC 2 cut(s) 105, 294
FspBI CTAG 1 cut(s) 290
GluI GCNGC 2 cut(s) 105, 294
GsuI CTGGAG 1 cut(s) 116
HgaI GACGC 1 cut(s) 141
Hin1I GRCGYC 1 cut(s) 133
Hin1II CATG 3 cut(s) 233, 275, 310
HinfI GANTC 2 cut(s) 20, 91
Hpy188I TCNGA 4 cut(s) 19, 76, 249, 261
Hpy188III TCNNGA 3 cut(s) 95, 188, 230
HpyAV CCTTC 2 cut(s) 112, 246
HpyCH4V TGCA 5 cut(s) 38, 181, 265, 296, 306
Hsp92I GRCGYC 1 cut(s) 133
Hsp92II CATG 3 cut(s) 233, 275, 310
Kzo9I GATC 2 cut(s) 4, 55
LpnPI CCDG 6 cut(s) 48, 80, 135, 162, 173, 237
Lsp1109I GCAGC 2 cut(s) 91, 280
LweI GCATC 2 cut(s) 252, 274
MaeI CTAG 1 cut(s) 290
MalI GATC 2 cut(s) 6, 57
MboI GATC 2 cut(s) 4, 55
MboII GAAGA 7 cut(s) 18, 92, 135, 138, 141, 245, 272
MflI RGATCY 1 cut(s) 55
MluCI AATT 6 cut(s) 10, 47, 64, 83, 144, 285
MnlI CCTC 2 cut(s) 37, 131
Mph1103I ATGCAT 2 cut(s) 267, 308
MseI TTAA 1 cut(s) 300
MslI CAYNNNNRTG 1 cut(s) 270
MspR9I CCNGG 1 cut(s) 150
MvaI CCWGG 1 cut(s) 150
NdeII GATC 2 cut(s) 4, 55
NlaIII CATG 3 cut(s) 233, 275, 310
NmeAIII GCCGAG 1 cut(s) 161
NsiI ATGCAT 2 cut(s) 267, 308
NspI RCATGY 2 cut(s) 275, 310
NspV TTCGAA 1 cut(s) 283
PagI TCATGA 1 cut(s) 229
PciI ACATGT 1 cut(s) 271
PfeI GAWTC 2 cut(s) 20, 91
PkrI GCNGC 2 cut(s) 106, 295
PscI ACATGT 1 cut(s) 271
Psp6I CCWGG 1 cut(s) 148
PspGI CCWGG 1 cut(s) 148
PstI CTGCAG 1 cut(s) 298
PsuI RGATCY 1 cut(s) 55
RseI CAYNNNNRTG 1 cut(s) 270
SaqAI TTAA 1 cut(s) 300
SatI GCNGC 2 cut(s) 105, 294
Sau3AI GATC 2 cut(s) 4, 55
ScrFI CCNGG 1 cut(s) 150
SetI ASST 2 cut(s) 187, 295
SfaNI GCATC 2 cut(s) 252, 274
SfcI CTRYAG 1 cut(s) 294
SfuI TTCGAA 1 cut(s) 283
SmiMI CAYNNNNRTG 1 cut(s) 270
Sse9I AATT 6 cut(s) 10, 47, 64, 83, 144, 285
SspMI CTAG 1 cut(s) 290
StyD4I CCNGG 1 cut(s) 148
TaqI TCGA 2 cut(s) 268, 283
TasI AATT 6 cut(s) 10, 47, 64, 83, 144, 285
TfiI GAWTC 2 cut(s) 20, 91
Tru1I TTAA 1 cut(s) 300
Tru9I TTAA 1 cut(s) 300
TseI GCWGC 2 cut(s) 104, 293
TspDTI ATGAA 5 cut(s) 12, 57, 104, 218, 246
XapI RAATTY 3 cut(s) 10, 47, 285
XceI RCATGY 2 cut(s) 275, 310
XspI CTAG 1 cut(s) 290
Zsp2I ATGCAT 2 cut(s) 267, 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.