Rmu_sc0019463.1_g000004

Ribosomal protein-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019463.1
Physical Location & Seq
Reverse (-)
5920 .. 6216
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019463.1_g000004.1.cds

Sequence Viewer

Length: 297 bp
atgaggatgcttgcgtatggaattggggtagatgctgtggatgactatcttagaatcggtgaaagcactgtaattgaagctatgaaaaggtttgtccaagctgttatctttgtatttggagctgaatacttaagaaagccaacttctgatgatatttccatattgttattgattggtgagagtcgtggatttcctggaatgcttggtagtatcgattgtatgcactggaagtggaagaattgtctggttgcatggaaaggtatgttttctcgtggagatcatcgtgaccttcattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.15

Weight (kDa)

6.82

Isoelectric Point (pI)

32.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 130
AgsI TTSAA 1 cut(s) 77
AjnI CCWGG 1 cut(s) 193
AluBI AGCT 3 cut(s) 80, 101, 122
AluI AGCT 3 cut(s) 80, 101, 122
AsuHPI GGTGA 2 cut(s) 71, 188
BauI CACGAG 1 cut(s) 270
BciT130I CCWGG 1 cut(s) 195
BfrI CTTAAG 1 cut(s) 130
Bme1390I CCNGG 1 cut(s) 195
BmrFI CCNGG 1 cut(s) 195
BmsI GCATC 1 cut(s) 22
Bsa29I ATCGAT 1 cut(s) 213
BsaBI GATNNNNATC 1 cut(s) 45
Bse1I ACTGG 1 cut(s) 230
Bse8I GATNNNNATC 1 cut(s) 45
BseBI CCWGG 1 cut(s) 195
BseCI ATCGAT 1 cut(s) 213
BseGI GGATG 2 cut(s) 12, 46
BseJI GATNNNNATC 1 cut(s) 45
BseNI ACTGG 1 cut(s) 230
BshVI ATCGAT 1 cut(s) 213
BsmI GAATGC 1 cut(s) 204
Bsp143I GATC 1 cut(s) 277
BspDI ATCGAT 1 cut(s) 213
BspTI CTTAAG 1 cut(s) 130
BsrI ACTGG 1 cut(s) 230
BssMI GATC 1 cut(s) 277
BssSI CACGAG 1 cut(s) 270
Bst2BI CACGAG 1 cut(s) 270
Bst2UI CCWGG 1 cut(s) 195
Bst4CI ACNGT 1 cut(s) 70
BstAFI CTTAAG 1 cut(s) 130
BstC8I GCNNGC 1 cut(s) 12
BstDEI CTNAG 1 cut(s) 50
BstF5I GGATG 2 cut(s) 12, 46
BstKTI GATC 1 cut(s) 280
BstMBI GATC 1 cut(s) 277
BstNI CCWGG 1 cut(s) 195
BstSCI CCNGG 1 cut(s) 193
Bsu15I ATCGAT 1 cut(s) 213
BsuTUI ATCGAT 1 cut(s) 213
BtsCI GGATG 2 cut(s) 12, 46
BtsIMutI CAGTG 2 cut(s) 66, 223
Cac8I GCNNGC 1 cut(s) 12
ClaI ATCGAT 1 cut(s) 213
CviAII CATG 1 cut(s) 252
CviJI RGCY 4 cut(s) 80, 101, 122, 139
CviKI_1 RGCY 4 cut(s) 80, 101, 122, 139
DdeI CTNAG 1 cut(s) 50
DpnI GATC 1 cut(s) 279
DpnII GATC 1 cut(s) 277
EcoRII CCWGG 1 cut(s) 193
FaeI CATG 1 cut(s) 255
FaiI YATR 6 cut(s) 18, 83, 161, 221, 253, 263
FatI CATG 1 cut(s) 251
FokI GGATG 2 cut(s) 19, 53
Hin1II CATG 1 cut(s) 255
HinfI GANTC 2 cut(s) 54, 181
HphI GGTGA 2 cut(s) 71, 188
Hpy188I TCNGA 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 284
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4V TGCA 2 cut(s) 223, 251
HpyF3I CTNAG 1 cut(s) 50
Hsp92II CATG 1 cut(s) 255
Kzo9I GATC 1 cut(s) 277
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 4 cut(s) 180, 207, 211, 230
LweI GCATC 1 cut(s) 22
MaeIII GTNAC 1 cut(s) 284
MalI GATC 1 cut(s) 279
MboI GATC 1 cut(s) 277
MboII GAAGA 1 cut(s) 247
MluCI AATT 3 cut(s) 21, 72, 238
MlyI GAGTC 1 cut(s) 190
MseI TTAA 1 cut(s) 131
MspCI CTTAAG 1 cut(s) 130
MspR9I CCNGG 1 cut(s) 195
Mva1269I GAATGC 1 cut(s) 204
MvaI CCWGG 1 cut(s) 195
NdeII GATC 1 cut(s) 277
NlaIII CATG 1 cut(s) 255
NmuCI GTSAC 1 cut(s) 284
PctI GAATGC 1 cut(s) 204
PfeI GAWTC 1 cut(s) 54
PfoI TCCNGGA 1 cut(s) 193
PleI GAGTC 1 cut(s) 189
PpsI GAGTC 1 cut(s) 189
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
SaqAI TTAA 1 cut(s) 131
Sau3AI GATC 1 cut(s) 277
SchI GAGTC 1 cut(s) 190
ScrFI CCNGG 1 cut(s) 195
SetI ASST 6 cut(s) 82, 92, 103, 124, 262, 291
SfaNI GCATC 1 cut(s) 22
SmlI CTYRAG 1 cut(s) 130
SmoI CTYRAG 1 cut(s) 130
Sse9I AATT 3 cut(s) 21, 72, 238
StyD4I CCNGG 1 cut(s) 193
TaaI ACNGT 1 cut(s) 70
TaqI TCGA 1 cut(s) 213
TasI AATT 3 cut(s) 21, 72, 238
TfiI GAWTC 1 cut(s) 54
Tru1I TTAA 1 cut(s) 131
Tru9I TTAA 1 cut(s) 131
TscAI CASTG 2 cut(s) 73, 230
TseFI GTSAC 1 cut(s) 284
Tsp45I GTSAC 1 cut(s) 284
TspDTI ATGAA 2 cut(s) 98, 281
TspRI CASTG 2 cut(s) 73, 230
Vha464I CTTAAG 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.