Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr06

Orthogroup ID

OG0001935

Physical Location & Seq

Genomic Coordinates Forward (+)

19739454 .. 19739768

Gene Structure 315 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD06G1080700.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 315 bp

ATGAGTGATCGCAAGCTTGATCTCTTGACTGCCACTCCGCAGAGCCTGAAGCCCGACATGGTTGTGGCTCAAGATGGGACAGGCAAGTACAAGACCATCAACGAGGCCTTGAAGGAGGTCCCACCAACTAGTAAGAAGACCTTTGTGATTCATATTAAGGGGGGAGTGTACAAAGAAATTGTCGTCGTTAACAAGCAAATGACCAATGTTGTGATGATTAGTGACGGCCCAACCAAGACCAGGATCACCGGAGGCTTGAACACCATGAAATCTCTGATCCATTTGTGGGTCTGGTTTTTGGCCAAAGAAAATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004857 GO:0005575 GO:0005623 GO:0008150 GO:0016787 GO:0016788 GO:0030234 GO:0030599 GO:0043086 GO:0044092 GO:0044464 GO:0046910 GO:0050790 GO:0052689 GO:0065007 GO:0065009 GO:0071944 GO:0098772

KEGG Pathways

Metabolic & Signaling

ko00040 ko01100 map00040 map01100

Pfam Domains

Protein Families

PMEI Pectinesterase

Protein Analysis

105

Amino Acids

11.58

Weight (kDa)

9.7

Isoelectric Point (pI)

30.18

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Pectinesterase	PF01095	19 - 90	1.6e-23	Pectinesterase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001935)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g17310 FvH4_6g17430
malus_domestica	MD01G1105400.v1.1 MD03G1086400.v1.1 MD04G1225800.v1.1 MD06G1080700.v1.1
prunus_persica	Prupe.2G210700_v2.0.a1 Prupe.2G216300_v2.0.a1 Prupe.6G344600_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0362901 RchiOBHm_Chr1g0362911 RchiOBHm_Chr3g0450671 RchiOBHm_Chr3g0471441
rosa_laevigata	RLG00000024178 RLG00000025712
rosa_multiflora	Rmu_co8224930.1_g000001 Rmu_co8324923.1_g000001 Rmu_sc0000078.1_g000035 Rmu_sc0001502.1_g000007 Rmu_sc0001502.1_g000008 Rmu_sc0006582.1_g000010
rosa_roxburghii	Rroxscaffold_4G00293660 Rroxscaffold_6G00409950 Rroxscaffold_6G00428330
rosa_rugosa	Rorug01G0302100 Rorug01G0302100 Rorug02G0629500 Rorug03G0117800
rosa_samantha	Rh1AG311400 Rh1AG311500 Rh1BG274600 Rh1CG291800 Rh1DG305300 Rh3AG030300 Rh3AG167600 Rh3BG030600 Rh3BG030700 Rh3BG193100 Rh3CG029500 Rh3CG183500 Rh3DG030200 Rh3DG030300 Rh3DG182400
rosa_wichuraiana	Rw1G027600 Rw3G002330 Rw3G015790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	38
AclWI	GGATC	2 cut(s)	251, 271
AcoI	YGGCCR	1 cut(s)	300
AcuI	CTGAAG	1 cut(s)	68
AfaI	GTAC	2 cut(s)	89, 170
AfiI	CCNNNNNNNGG	2 cut(s)	240, 286
AgsI	TTSAA	2 cut(s)	112, 259
AhlI	ACTAGT	1 cut(s)	128
AjnI	CCWGG	1 cut(s)	239
AluBI	AGCT	1 cut(s)	16
AluI	AGCT	1 cut(s)	16
AlwI	GGATC	2 cut(s)	251, 271
AlwNI	CAGNNNCTG	1 cut(s)	46
AoxI	GGCC	3 cut(s)	105, 226, 300
ArsI	GACNNNNNNTTYG	2 cut(s)	165, 197
AspS9I	GGNCC	2 cut(s)	118, 227
AsuHPI	GGTGA	1 cut(s)	238
AvaII	GGWCC	1 cut(s)	118
BalI	TGGCCA	1 cut(s)	302
BbsI	GAAGAC	1 cut(s)	143
BccI	CCATC	2 cut(s)	68, 104
BceAI	ACGGC	1 cut(s)	241
BciT130I	CCWGG	1 cut(s)	241
BcuI	ACTAGT	1 cut(s)	128
BfaI	CTAG	1 cut(s)	129
Bme1390I	CCNGG	1 cut(s)	241
Bme18I	GGWCC	1 cut(s)	118
BmgT120I	GGNCC	2 cut(s)	118, 227
BmiI	GGNNCC	1 cut(s)	120
BmrFI	CCNGG	1 cut(s)	241
BpiI	GAAGAC	1 cut(s)	143
BpuEI	CTTGAG	1 cut(s)	54
BsaWI	WCCGGW	1 cut(s)	248
BsaXI	ACNNNNNCTCC	2 cut(s)	19, 49
Bsc4I	CCNNNNNNNGG	2 cut(s)	240, 286
BseBI	CCWGG	1 cut(s)	241
BseLI	CCNNNNNNNGG	2 cut(s)	240, 286
BshFI	GGCC	3 cut(s)	107, 228, 302
BsiSI	CCGG	1 cut(s)	249
BslFI	GGGAC	2 cut(s)	91, 104
BslI	CCNNNNNNNGG	2 cut(s)	240, 286
BsmFI	GGGAC	2 cut(s)	91, 104
BsnI	GGCC	3 cut(s)	107, 228, 302
Bsp1407I	TGTACA	1 cut(s)	168
Bsp143I	GATC	4 cut(s)	7, 19, 243, 276
BspACI	CCGC	1 cut(s)	38
BspANI	GGCC	3 cut(s)	107, 228, 302
BspLI	GGNNCC	1 cut(s)	120
BspPI	GGATC	2 cut(s)	251, 271
BsrGI	TGTACA	1 cut(s)	168
BssMI	GATC	4 cut(s)	7, 19, 243, 276
Bst2UI	CCWGG	1 cut(s)	241
BstAUI	TGTACA	1 cut(s)	168
BstC8I	GCNNGC	1 cut(s)	14
BstKTI	GATC	4 cut(s)	10, 22, 246, 279
BstMBI	GATC	4 cut(s)	7, 19, 243, 276
BstNI	CCWGG	1 cut(s)	241
BstSCI	CCNGG	1 cut(s)	239
BstV2I	GAAGAC	1 cut(s)	143
BsuRI	GGCC	3 cut(s)	107, 228, 302
Cac8I	GCNNGC	1 cut(s)	14
CaiI	CAGNNNCTG	1 cut(s)	46
Cfr13I	GGNCC	2 cut(s)	118, 227
Csp6I	GTAC	2 cut(s)	88, 169
CviAII	CATG	2 cut(s)	58, 265
CviJI	RGCY	8 cut(s)	16, 45, 52, 68, 107, 228, 255, 302
CviKI_1	RGCY	8 cut(s)	16, 45, 52, 68, 107, 228, 255, 302
CviQI	GTAC	2 cut(s)	88, 169
DpnI	GATC	4 cut(s)	9, 21, 245, 278
DpnII	GATC	4 cut(s)	7, 19, 243, 276
EaeI	YGGCCR	1 cut(s)	300
Eco147I	AGGCCT	1 cut(s)	107
Eco47I	GGWCC	1 cut(s)	118
Eco57I	CTGAAG	1 cut(s)	68
EcoO109I	RGGNCCY	1 cut(s)	118
EcoRII	CCWGG	1 cut(s)	239
FaeI	CATG	2 cut(s)	61, 268
FaiI	YATR	3 cut(s)	59, 153, 266
FalI	AAGNNNNNCTT	2 cut(s)	125, 157
FaqI	GGGAC	2 cut(s)	91, 104
FatI	CATG	2 cut(s)	57, 264
FspBI	CTAG	1 cut(s)	129
HaeIII	GGCC	3 cut(s)	107, 228, 302
HapII	CCGG	1 cut(s)	249
Hin1II	CATG	2 cut(s)	61, 268
HincII	GTYRAC	1 cut(s)	190
HindII	GTYRAC	1 cut(s)	190
HindIII	AAGCTT	1 cut(s)	14
HinfI	GANTC	1 cut(s)	148
HpaI	GTTAAC	1 cut(s)	190
HpaII	CCGG	1 cut(s)	249
HphI	GGTGA	1 cut(s)	238
Hpy166II	GTNNAC	2 cut(s)	169, 190
Hpy188I	TCNGA	1 cut(s)	276
Hpy188III	TCNNGA	2 cut(s)	25, 71
Hpy8I	GTNNAC	2 cut(s)	169, 190
Hpy99I	CGWCG	1 cut(s)	188
HpyAV	CCTTC	1 cut(s)	106
Hsp92II	CATG	2 cut(s)	61, 268
KspAI	GTTAAC	1 cut(s)	190
Kzo9I	GATC	4 cut(s)	7, 19, 243, 276
LpnPI	CCDG	6 cut(s)	59, 66, 226, 253, 262, 277
MaeI	CTAG	1 cut(s)	129
MaeIII	GTNAC	1 cut(s)	221
MalI	GATC	4 cut(s)	9, 21, 245, 278
MboI	GATC	4 cut(s)	7, 19, 243, 276
MboII	GAAGA	1 cut(s)	148
MlsI	TGGCCA	1 cut(s)	302
MluCI	AATT	2 cut(s)	177, 310
MluNI	TGGCCA	1 cut(s)	302
MnlI	CCTC	3 cut(s)	97, 109, 245
Mox20I	TGGCCA	1 cut(s)	302
MscI	TGGCCA	1 cut(s)	302
MseI	TTAA	2 cut(s)	156, 189
MslI	CAYNNNNRTG	1 cut(s)	62
Msp20I	TGGCCA	1 cut(s)	302
MspI	CCGG	1 cut(s)	249
MspR9I	CCNGG	1 cut(s)	241
MvaI	CCWGG	1 cut(s)	241
NdeII	GATC	4 cut(s)	7, 19, 243, 276
NlaIII	CATG	2 cut(s)	61, 268
NlaIV	GGNNCC	1 cut(s)	120
NmuCI	GTSAC	1 cut(s)	221
PceI	AGGCCT	1 cut(s)	107
PfeI	GAWTC	1 cut(s)	148
PpuMI	RGGWCCY	1 cut(s)	118
Psp5II	RGGWCCY	1 cut(s)	118
Psp6I	CCWGG	1 cut(s)	239
PspGI	CCWGG	1 cut(s)	239
PspN4I	GGNNCC	1 cut(s)	120
PspPI	GGNCC	2 cut(s)	118, 227
PspPPI	RGGWCCY	1 cut(s)	118
PstNI	CAGNNNCTG	1 cut(s)	46
RsaI	GTAC	2 cut(s)	89, 170
RsaNI	GTAC	2 cut(s)	88, 169
RseI	CAYNNNNRTG	1 cut(s)	62
SaqAI	TTAA	2 cut(s)	156, 189
Sau3AI	GATC	4 cut(s)	7, 19, 243, 276
Sau96I	GGNCC	2 cut(s)	118, 227
ScrFI	CCNGG	1 cut(s)	241
SetI	ASST	3 cut(s)	18, 120, 143
SinI	GGWCC	1 cut(s)	118
SmiMI	CAYNNNNRTG	1 cut(s)	62
SmlI	CTYRAG	1 cut(s)	69
SmoI	CTYRAG	1 cut(s)	69
SpeI	ACTAGT	1 cut(s)	128
Sse9I	AATT	2 cut(s)	177, 310
SseBI	AGGCCT	1 cut(s)	107
SsiI	CCGC	1 cut(s)	38
SspMI	CTAG	1 cut(s)	129
StuI	AGGCCT	1 cut(s)	107
StyD4I	CCNGG	1 cut(s)	239
TasI	AATT	2 cut(s)	177, 310
TatI	WGTACW	2 cut(s)	87, 168
TfiI	GAWTC	1 cut(s)	148
Tru1I	TTAA	2 cut(s)	156, 189
Tru9I	TTAA	2 cut(s)	156, 189
TseFI	GTSAC	1 cut(s)	221
Tsp45I	GTSAC	1 cut(s)	221
TspDTI	ATGAA	2 cut(s)	140, 281
VpaK11BI	GGWCC	1 cut(s)	118
XspI	CTAG	1 cut(s)	129

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.