MD08G1216400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0001184
Physical Location & Seq
Forward (+)
27914493 .. 27914813
321 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1216400.v1.1.491

Sequence Viewer

Length: 321 bp
ATGAATGGACTTCGGAGCCGCCATTGCCAACGATGTCTGCAGCTGCAAATCCTAGTTCTCCTCCTCTTGTCCATTAGCCTCCTATTCGATTTAGGTTCGGCAGACGAGCCCTCAACTCCCAAGAACGGAGACAAAGCTTCAAGTGGGTCGGCGGCCCTCAAGGCAGTGATTGTGCTGCTGGGAGTGGCGGCTGTCATCGGCTTCTGCGTCTTCTTGTTCAAGATATGGCAGAAGAAGAAGAGAGAAGAGCAACACGCCCGTCTTCTTAAGCTCTTTGAAGACGACGATGAACTCGAGGTTGAGCTTGGCATTAGGGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.79

Weight (kDa)

6.72

Isoelectric Point (pI)

33.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 19, 152, 188
AfiI CCNNNNNNNGG 1 cut(s) 125
AflII CTTAAG 1 cut(s) 266
AgsI TTSAA 3 cut(s) 141, 220, 278
AluBI AGCT 4 cut(s) 43, 137, 271, 304
AluI AGCT 4 cut(s) 43, 137, 271, 304
Alw26I GTCTC 1 cut(s) 123
Ama87I CYCGRG 1 cut(s) 293
AoxI GGCC 1 cut(s) 153
ApeKI GCWGC 3 cut(s) 40, 43, 175
AspS9I GGNCC 1 cut(s) 154
AvaI CYCGRG 1 cut(s) 293
BanII GRGCYC 1 cut(s) 111
BbsI GAAGAC 3 cut(s) 202, 254, 285
BbvI GCAGC 3 cut(s) 30, 52, 162
BcoDI GTCTC 1 cut(s) 123
BfaI CTAG 1 cut(s) 53
BfmI CTRYAG 1 cut(s) 38
BfrI CTTAAG 1 cut(s) 266
BglI GCCNNNNNGGC 1 cut(s) 161
BisI GCNGC 6 cut(s) 19, 41, 44, 153, 176, 189
BlsI GCNGC 6 cut(s) 20, 42, 45, 154, 177, 190
BmeT110I CYCGRG 1 cut(s) 293
BmgT120I GGNCC 1 cut(s) 154
BmiI GGNNCC 1 cut(s) 17
BpiI GAAGAC 3 cut(s) 202, 254, 285
BpuEI CTTGAG 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 125
Bse3DI GCAATG 1 cut(s) 22
BseLI CCNNNNNNNGG 1 cut(s) 125
BseMI GCAATG 1 cut(s) 22
BseRI GAGGAG 2 cut(s) 50, 53
BseXI GCAGC 3 cut(s) 30, 52, 162
BseYI CCCAGC 1 cut(s) 178
BshFI GGCC 1 cut(s) 155
BsiHKCI CYCGRG 1 cut(s) 293
BslI CCNNNNNNNGG 1 cut(s) 125
BsmAI GTCTC 1 cut(s) 123
BsnI GGCC 1 cut(s) 155
BsoBI CYCGRG 1 cut(s) 293
Bsp1286I GDGCHC 1 cut(s) 111
BspACI CCGC 3 cut(s) 19, 152, 188
BspANI GGCC 1 cut(s) 155
BspLI GGNNCC 1 cut(s) 17
BspMAI CTGCAG 1 cut(s) 42
BspQI GCTCTTC 1 cut(s) 240
BspTI CTTAAG 1 cut(s) 266
BsrDI GCAATG 1 cut(s) 22
Bst6I CTCTTC 2 cut(s) 233, 240
BstAFI CTTAAG 1 cut(s) 266
BstMAI GTCTC 1 cut(s) 123
BstMWI GCNNNNNNNGC 2 cut(s) 24, 161
BstSFI CTRYAG 1 cut(s) 38
BstV1I GCAGC 3 cut(s) 30, 52, 162
BstV2I GAAGAC 3 cut(s) 202, 254, 285
BsuRI GGCC 1 cut(s) 155
BtsI GCAGTG 1 cut(s) 171
BtsIMutI CAGTG 1 cut(s) 171
Cfr13I GGNCC 1 cut(s) 154
CseI GACGC 1 cut(s) 196
Eam1104I CTCTTC 2 cut(s) 233, 240
EarI CTCTTC 2 cut(s) 233, 240
Eco24I GRGCYC 1 cut(s) 111
Eco88I CYCGRG 1 cut(s) 293
EcoT38I GRGCYC 1 cut(s) 111
FaiI YATR 1 cut(s) 226
Fnu4HI GCNGC 6 cut(s) 19, 41, 44, 153, 176, 189
FriOI GRGCYC 1 cut(s) 111
Fsp4HI GCNGC 6 cut(s) 19, 41, 44, 153, 176, 189
FspBI CTAG 1 cut(s) 53
GluI GCNGC 6 cut(s) 19, 41, 44, 153, 176, 189
GsaI CCCAGC 1 cut(s) 182
HaeIII GGCC 1 cut(s) 155
HgaI GACGC 1 cut(s) 196
HindIII AAGCTT 1 cut(s) 135
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 1 cut(s) 220
Hpy99I CGWCG 1 cut(s) 287
HpyCH4V TGCA 2 cut(s) 40, 46
HpyF10VI GCNNNNNNNGC 2 cut(s) 24, 161
LguI GCTCTTC 1 cut(s) 240
LmnI GCTCC 1 cut(s) 15
LpnPI CCDG 1 cut(s) 164
Lsp1109I GCAGC 3 cut(s) 30, 52, 162
MaeI CTAG 1 cut(s) 53
MboII GAAGA 7 cut(s) 202, 244, 247, 250, 254, 257, 290
MhlI GDGCHC 1 cut(s) 111
MnlI CCTC 6 cut(s) 71, 74, 89, 121, 167, 289
MseI TTAA 1 cut(s) 267
MspA1I CMGCKG 1 cut(s) 43
MspCI CTTAAG 1 cut(s) 266
MwoI GCNNNNNNNGC 2 cut(s) 24, 161
NlaIV GGNNCC 1 cut(s) 17
PaeR7I CTCGAG 1 cut(s) 293
PciSI GCTCTTC 1 cut(s) 240
PcsI WCGNNNNNNNCGW 2 cut(s) 204, 291
PkrI GCNGC 6 cut(s) 20, 42, 45, 154, 177, 190
PspFI CCCAGC 1 cut(s) 178
PspN4I GGNNCC 1 cut(s) 17
PspPI GGNCC 1 cut(s) 154
PspXI VCTCGAGB 1 cut(s) 293
PstI CTGCAG 1 cut(s) 42
PvuII CAGCTG 1 cut(s) 43
SapI GCTCTTC 1 cut(s) 240
SaqAI TTAA 1 cut(s) 267
SatI GCNGC 6 cut(s) 19, 41, 44, 153, 176, 189
Sau96I GGNCC 1 cut(s) 154
SduI GDGCHC 1 cut(s) 111
SetI ASST 6 cut(s) 45, 97, 139, 273, 300, 306
SfcI CTRYAG 1 cut(s) 38
Sfr274I CTCGAG 1 cut(s) 293
SlaI CTCGAG 1 cut(s) 293
SmlI CTYRAG 3 cut(s) 158, 266, 293
SmoI CTYRAG 3 cut(s) 158, 266, 293
SsiI CCGC 3 cut(s) 19, 152, 188
SspMI CTAG 1 cut(s) 53
TaqI TCGA 2 cut(s) 87, 294
TauI GCSGC 3 cut(s) 21, 155, 191
Tru1I TTAA 1 cut(s) 267
Tru9I TTAA 1 cut(s) 267
TscAI CASTG 1 cut(s) 171
TseI GCWGC 3 cut(s) 40, 43, 175
TspDTI ATGAA 2 cut(s) 17, 303
TspGWI ACGGA 1 cut(s) 141
TspRI CASTG 1 cut(s) 171
Vha464I CTTAAG 1 cut(s) 266
XhoI CTCGAG 1 cut(s) 293
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.