Rroxscaffold_3G00239350

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
29550380 .. 29552651
2272 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00239350.1

Sequence Viewer

Length: 309 bp
ATGAGTGAAATTTCAGGTTGCAGATCGTTGAGTTCGCTCTTGTTATTGGGTACAATTTTCCTACAATTCATTCCAGGGTTATCTGATGATGGCAAAAACAGTACAAAGCCTGTGAGTGATGCTACCTCCAACAGCAGAAATGGGTCTACATTGGCCTTTATACCTTTTGGACTTGTAGTAGTTGGATTGTTATCTTTTTTCCTCTTTAAGCTATGGCAAAAGAAGAAACGAGAAGAGCAGTATGCTCGTCTTTTGAAGTTGTTTGAAGAAGATGATGAGCTTGAGCTTGAACTTGGTCTCCGGGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.43

Weight (kDa)

5.14

Isoelectric Point (pI)

43.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 146
AcsI RAATTY 1 cut(s) 9
AfaI GTAC 2 cut(s) 52, 103
AgsI TTSAA 3 cut(s) 256, 266, 290
AjnI CCWGG 1 cut(s) 73
AloI GAACNNNNNNTCC 1 cut(s) 282
AluBI AGCT 3 cut(s) 211, 280, 286
AluI AGCT 3 cut(s) 211, 280, 286
Alw26I GTCTC 1 cut(s) 302
AoxI GGCC 1 cut(s) 153
ApoI RAATTY 1 cut(s) 9
AsuC2I CCSGG 1 cut(s) 302
BccI CCATC 1 cut(s) 83
BcgI CGANNNNNNTGC 2 cut(s) 227, 261
BciT130I CCWGG 1 cut(s) 75
BcnI CCSGG 1 cut(s) 302
BcoDI GTCTC 1 cut(s) 302
Bme1390I CCNGG 2 cut(s) 75, 302
BmrFI CCNGG 2 cut(s) 75, 302
BmsI GCATC 1 cut(s) 109
BpuEI CTTGAG 1 cut(s) 302
BpuMI CCSGG 1 cut(s) 302
BsaBI GATNNNNATC 1 cut(s) 190
BsaI GGTCTC 1 cut(s) 302
BsaJI CCNNGG 1 cut(s) 74
BsaXI ACNNNNNCTCC 1 cut(s) 282
Bse8I GATNNNNATC 1 cut(s) 190
BseBI CCWGG 1 cut(s) 75
BseDI CCNNGG 1 cut(s) 74
BseJI GATNNNNATC 1 cut(s) 190
BshFI GGCC 1 cut(s) 155
BsiSI CCGG 1 cut(s) 301
BsmAI GTCTC 1 cut(s) 302
BsnI GGCC 1 cut(s) 155
Bso31I GGTCTC 1 cut(s) 302
Bsp143I GATC 1 cut(s) 23
BspANI GGCC 1 cut(s) 155
BspQI GCTCTTC 1 cut(s) 228
BspTNI GGTCTC 1 cut(s) 302
BssECI CCNNGG 1 cut(s) 74
BssMI GATC 1 cut(s) 23
Bst2UI CCWGG 1 cut(s) 75
Bst4CI ACNGT 1 cut(s) 101
Bst6I CTCTTC 1 cut(s) 228
BstKTI GATC 1 cut(s) 26
BstMAI GTCTC 1 cut(s) 302
BstMBI GATC 1 cut(s) 23
BstNI CCWGG 1 cut(s) 75
BstSCI CCNGG 2 cut(s) 73, 300
BsuRI GGCC 1 cut(s) 155
Csp6I GTAC 2 cut(s) 51, 102
CviJI RGCY 5 cut(s) 109, 155, 211, 280, 286
CviKI_1 RGCY 5 cut(s) 109, 155, 211, 280, 286
CviQI GTAC 2 cut(s) 51, 102
DpnI GATC 1 cut(s) 25
DpnII GATC 1 cut(s) 23
Eam1104I CTCTTC 1 cut(s) 228
EarI CTCTTC 1 cut(s) 228
Eco31I GGTCTC 1 cut(s) 302
EcoRII CCWGG 1 cut(s) 73
FaiI YATR 3 cut(s) 161, 214, 243
FblI GTMKAC 1 cut(s) 146
HaeIII GGCC 1 cut(s) 155
HapII CCGG 1 cut(s) 301
HpaII CCGG 1 cut(s) 301
Hpy166II GTNNAC 1 cut(s) 147
Hpy188I TCNGA 1 cut(s) 85
Hpy8I GTNNAC 1 cut(s) 147
HpyCH4III ACNGT 1 cut(s) 101
HpyCH4V TGCA 1 cut(s) 21
Kzo9I GATC 1 cut(s) 23
LguI GCTCTTC 1 cut(s) 228
LpnPI CCDG 3 cut(s) 60, 87, 123
LweI GCATC 1 cut(s) 109
MalI GATC 1 cut(s) 25
MboI GATC 1 cut(s) 23
MboII GAAGA 4 cut(s) 235, 245, 278, 281
MluCI AATT 3 cut(s) 9, 54, 65
MmeI TCCRAC 2 cut(s) 153, 163
MnlI CCTC 2 cut(s) 136, 212
MseI TTAA 1 cut(s) 207
MspI CCGG 1 cut(s) 301
MspR9I CCNGG 2 cut(s) 75, 302
MvaI CCWGG 1 cut(s) 75
NciI CCSGG 1 cut(s) 302
NdeII GATC 1 cut(s) 23
PciSI GCTCTTC 1 cut(s) 228
PfoI TCCNGGA 1 cut(s) 300
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
RsaI GTAC 2 cut(s) 52, 103
RsaNI GTAC 2 cut(s) 51, 102
SapI GCTCTTC 1 cut(s) 228
SaqAI TTAA 1 cut(s) 207
Sau3AI GATC 1 cut(s) 23
ScrFI CCNGG 2 cut(s) 75, 302
SetI ASST 6 cut(s) 19, 128, 166, 213, 282, 288
SfaNI GCATC 1 cut(s) 109
SmlI CTYRAG 1 cut(s) 281
SmoI CTYRAG 1 cut(s) 281
Sse9I AATT 3 cut(s) 9, 54, 65
StyD4I CCNGG 2 cut(s) 73, 300
TaaI ACNGT 1 cut(s) 101
TasI AATT 3 cut(s) 9, 54, 65
TatI WGTACW 1 cut(s) 101
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TspDTI ATGAA 1 cut(s) 58
XapI RAATTY 1 cut(s) 9
XmiI GTMKAC 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.