MD10G1128000.v1.1

SecE/Sec61-gamma subunits of protein translocation complex

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0003022
Physical Location & Seq
Reverse (-)
20859677 .. 20860744
1068 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1128000.v1.1.491

Sequence Viewer

Length: 210 bp
ATGGATGTGAGATGGGGGCTGCTTCGTAGTCGGTGGCAAGCTGCTGTTCAGCCTAGTCAGTTGAAGTACATTGAATGGCCAAGCTTCCGCAACACGCTTAAGACTGCTAGACTTACTCTTGTTCTTGTGGTGCTACTCATCGTGGCACTTTCATCAACGGACTCTGCCCTCAGCTATCTGTTGGCTTTGATTCTCAGGCGAACCCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SecE

Protein Analysis

70

Amino Acids

7.91

Weight (kDa)

11.31

Isoelectric Point (pI)

68.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SecE PF00584 20 - 65 2e-07 SecE/Sec61-gamma subunits of protein translocation complex
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 88
AcoI YGGCCR 1 cut(s) 77
AfaI GTAC 1 cut(s) 68
AflII CTTAAG 1 cut(s) 98
AgsI TTSAA 2 cut(s) 64, 74
AluBI AGCT 3 cut(s) 41, 84, 174
AluI AGCT 3 cut(s) 41, 84, 174
AoxI GGCC 1 cut(s) 77
ApeKI GCWGC 2 cut(s) 19, 41
BalI TGGCCA 1 cut(s) 79
BbvCI CCTCAGC 1 cut(s) 170
BbvI GCAGC 2 cut(s) 6, 28
BccI CCATC 1 cut(s) 6
BfaI CTAG 2 cut(s) 54, 108
BfrI CTTAAG 1 cut(s) 98
BisI GCNGC 2 cut(s) 20, 42
BlsI GCNGC 2 cut(s) 21, 43
Bpu10I CCTNAGC 1 cut(s) 170
BseGI GGATG 1 cut(s) 10
BseMII CTCAG 2 cut(s) 184, 208
BseXI GCAGC 2 cut(s) 6, 28
BshFI GGCC 1 cut(s) 79
BsnI GGCC 1 cut(s) 79
BspACI CCGC 1 cut(s) 88
BspANI GGCC 1 cut(s) 79
BspCNI CTCAG 2 cut(s) 183, 207
BspTI CTTAAG 1 cut(s) 98
BstAFI CTTAAG 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 39
BstDEI CTNAG 2 cut(s) 170, 194
BstF5I GGATG 1 cut(s) 10
BstV1I GCAGC 2 cut(s) 6, 28
BsuRI GGCC 1 cut(s) 79
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 39
Csp6I GTAC 1 cut(s) 67
CviJI RGCY 7 cut(s) 19, 41, 52, 79, 84, 174, 185
CviKI_1 RGCY 7 cut(s) 19, 41, 52, 79, 84, 174, 185
CviQI GTAC 1 cut(s) 67
DdeI CTNAG 2 cut(s) 170, 194
EaeI YGGCCR 1 cut(s) 77
Fnu4HI GCNGC 2 cut(s) 20, 42
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 2 cut(s) 20, 42
FspBI CTAG 2 cut(s) 54, 108
GluI GCNGC 2 cut(s) 20, 42
HaeIII GGCC 1 cut(s) 79
HindIII AAGCTT 1 cut(s) 82
HinfI GANTC 2 cut(s) 161, 190
HpyF3I CTNAG 2 cut(s) 170, 194
LpnPI CCDG 1 cut(s) 181
Lsp1109I GCAGC 2 cut(s) 6, 28
MaeI CTAG 2 cut(s) 54, 108
MlsI TGGCCA 1 cut(s) 79
MluNI TGGCCA 1 cut(s) 79
MlyI GAGTC 1 cut(s) 155
MnlI CCTC 1 cut(s) 179
Mox20I TGGCCA 1 cut(s) 79
MscI TGGCCA 1 cut(s) 79
MseI TTAA 1 cut(s) 99
Msp20I TGGCCA 1 cut(s) 79
MspCI CTTAAG 1 cut(s) 98
PfeI GAWTC 1 cut(s) 190
PkrI GCNGC 2 cut(s) 21, 43
PleI GAGTC 1 cut(s) 155
PpsI GAGTC 1 cut(s) 155
RsaI GTAC 1 cut(s) 68
RsaNI GTAC 1 cut(s) 67
SaqAI TTAA 1 cut(s) 99
SatI GCNGC 2 cut(s) 20, 42
SchI GAGTC 1 cut(s) 155
SetI ASST 3 cut(s) 43, 86, 176
SgeI CNNG 8 cut(s) 50, 66, 93, 106, 120, 131, 137, 154
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
SsiI CCGC 1 cut(s) 88
SspMI CTAG 2 cut(s) 54, 108
TatI WGTACW 1 cut(s) 66
TfiI GAWTC 1 cut(s) 190
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TseI GCWGC 2 cut(s) 19, 41
TspDTI ATGAA 1 cut(s) 141
TspGWI ACGGA 1 cut(s) 173
Vha464I CTTAAG 1 cut(s) 98
XspI CTAG 2 cut(s) 54, 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.