MD10G1168700.v1.1

glycine-rich protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Reverse (-)
26071847 .. 26074256
2410 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1168700.v1.1.491

Sequence Viewer

Length: 375 bp
ATGAACACCGTTCAGATAACATCCTGCCAGCCTAGCATCTATTTCAGAAACCCATCTCAATCTCTCCGCCTCTATTCTAGTCCGTGTTTGCTTCCAAATCGTGCTAAATGTCTCCTTGGAACTTCATTGAAACCAAAACATAATGCACGAATCCAGCAACAATGCGTGGCTGTACTGAAGAACCAGCAATGCGGGGTCGTATCTAAGTACCACCGATCTGCACCTGTCTGTTTATTGGGTGGCAAGGGAAAGAATGAAAACGGTGATGAGGGTTCCCCCTGGAAGGCTCTTGAGAAAGCAATGGGTAATTTCAAAAAGGAAGGGTCAATAGAGGATGTGCTACGTCAGCAGATTGAAAAGAAACGAATTCTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

13.83

Weight (kDa)

9.76

Isoelectric Point (pI)

58.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 67, 192
AcsI RAATTY 1 cut(s) 366
AcuI CTGAAG 1 cut(s) 197
AfaI GTAC 2 cut(s) 174, 209
AfiI CCNNNNNNNGG 1 cut(s) 283
AgsI TTSAA 3 cut(s) 130, 313, 356
AjnI CCWGG 1 cut(s) 278
Alw26I GTCTC 1 cut(s) 116
ApoI RAATTY 1 cut(s) 366
AsuHPI GGTGA 1 cut(s) 275
BccI CCATC 1 cut(s) 61
BciT130I CCWGG 1 cut(s) 280
BcoDI GTCTC 1 cut(s) 116
BfaI CTAG 2 cut(s) 33, 78
Bme1390I CCNGG 1 cut(s) 280
BmiI GGNNCC 1 cut(s) 274
BmrFI CCNGG 1 cut(s) 280
BmsI GCATC 1 cut(s) 45
BpuEI CTTGAG 1 cut(s) 311
BsaJI CCNNGG 2 cut(s) 115, 278
Bsc4I CCNNNNNNNGG 1 cut(s) 283
Bse3DI GCAATG 2 cut(s) 194, 306
BseBI CCWGG 1 cut(s) 280
BseDI CCNNGG 2 cut(s) 115, 278
BseGI GGATG 2 cut(s) 20, 340
BseLI CCNNNNNNNGG 1 cut(s) 283
BseMI GCAATG 2 cut(s) 194, 306
BsgI GTGCAG 1 cut(s) 204
BslI CCNNNNNNNGG 1 cut(s) 283
BsmAI GTCTC 1 cut(s) 116
Bsp143I GATC 1 cut(s) 215
BspACI CCGC 2 cut(s) 67, 192
BspLI GGNNCC 1 cut(s) 274
BsrDI GCAATG 2 cut(s) 194, 306
BssECI CCNNGG 2 cut(s) 115, 278
BssMI GATC 1 cut(s) 215
BssT1I CCWWGG 1 cut(s) 115
Bst2UI CCWGG 1 cut(s) 280
Bst4CI ACNGT 2 cut(s) 10, 263
BstC8I GCNNGC 1 cut(s) 29
BstDEI CTNAG 1 cut(s) 204
BstF5I GGATG 2 cut(s) 20, 340
BstKTI GATC 1 cut(s) 218
BstMAI GTCTC 1 cut(s) 116
BstMBI GATC 1 cut(s) 215
BstMWI GCNNNNNNNGC 2 cut(s) 33, 346
BstNI CCWGG 1 cut(s) 280
BstSCI CCNGG 1 cut(s) 278
BtsCI GGATG 2 cut(s) 20, 340
Cac8I GCNNGC 1 cut(s) 29
Csp6I GTAC 2 cut(s) 173, 208
CviJI RGCY 3 cut(s) 31, 170, 287
CviKI_1 RGCY 3 cut(s) 31, 170, 287
CviQI GTAC 2 cut(s) 173, 208
DdeI CTNAG 1 cut(s) 204
DpnI GATC 1 cut(s) 217
DpnII GATC 1 cut(s) 215
EciI GGCGGA 1 cut(s) 56
Eco130I CCWWGG 1 cut(s) 115
Eco57I CTGAAG 1 cut(s) 197
EcoRI GAATTC 1 cut(s) 366
EcoRII CCWGG 1 cut(s) 278
EcoT14I CCWWGG 1 cut(s) 115
ErhI CCWWGG 1 cut(s) 115
FaiI YATR 2 cut(s) 141, 373
FauI CCCGC 1 cut(s) 185
FokI GGATG 2 cut(s) 7, 347
FspBI CTAG 2 cut(s) 33, 78
HinfI GANTC 1 cut(s) 150
HphI GGTGA 1 cut(s) 275
Hpy188I TCNGA 2 cut(s) 15, 47
Hpy188III TCNNGA 1 cut(s) 290
HpyAV CCTTC 2 cut(s) 277, 314
HpyCH4III ACNGT 2 cut(s) 10, 263
HpyCH4IV ACGT 1 cut(s) 343
HpyCH4V TGCA 2 cut(s) 146, 221
HpyF10VI GCNNNNNNNGC 2 cut(s) 33, 346
HpyF3I CTNAG 1 cut(s) 204
HpySE526I ACGT 1 cut(s) 343
Kzo9I GATC 1 cut(s) 215
LpnPI CCDG 7 cut(s) 37, 41, 167, 197, 237, 265, 292
LweI GCATC 1 cut(s) 45
MaeI CTAG 2 cut(s) 33, 78
MaeII ACGT 1 cut(s) 343
MalI GATC 1 cut(s) 217
MboI GATC 1 cut(s) 215
MboII GAAGA 1 cut(s) 190
MluCI AATT 2 cut(s) 307, 366
MnlI CCTC 3 cut(s) 80, 262, 325
MspR9I CCNGG 1 cut(s) 280
MvaI CCWGG 1 cut(s) 280
MwoI GCNNNNNNNGC 2 cut(s) 33, 346
NdeII GATC 1 cut(s) 215
NlaIV GGNNCC 1 cut(s) 274
PfeI GAWTC 1 cut(s) 150
Psp6I CCWGG 1 cut(s) 278
PspGI CCWGG 1 cut(s) 278
PspN4I GGNNCC 1 cut(s) 274
RsaI GTAC 2 cut(s) 174, 209
RsaNI GTAC 2 cut(s) 173, 208
Sau3AI GATC 1 cut(s) 215
ScrFI CCNGG 1 cut(s) 280
SetI ASST 2 cut(s) 226, 346
SfaNI GCATC 1 cut(s) 45
SmlI CTYRAG 1 cut(s) 290
SmoI CTYRAG 1 cut(s) 290
Sse9I AATT 2 cut(s) 307, 366
SsiI CCGC 2 cut(s) 67, 192
SspMI CTAG 2 cut(s) 33, 78
StyD4I CCNGG 1 cut(s) 278
StyI CCWWGG 1 cut(s) 115
TaaI ACNGT 2 cut(s) 10, 263
TaiI ACGT 1 cut(s) 346
TasI AATT 2 cut(s) 307, 366
TatI WGTACW 1 cut(s) 172
TfiI GAWTC 1 cut(s) 150
TspDTI ATGAA 3 cut(s) 17, 114, 270
TspGWI ACGGA 1 cut(s) 72
XapI RAATTY 1 cut(s) 366
XspI CTAG 2 cut(s) 33, 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.