Rmu_sc0041989.1_g000001

glycine-rich protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0041989.1
Physical Location & Seq
Reverse (-)
290 .. 574
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0041989.1_g000001.1.cds

Sequence Viewer

Length: 285 bp
atgcttttgttgcagtatgtttacatcatcactggtgaggagtgggctcggctagcaaaggactacctcaagtttctcttttcagggtctgagagtgttcgtctaaaacgtgccatgtaccaatggggaaggttctaccagaagctgactgagaagaaggtgtatgataagttctggttggagaaggccataatcagtaccccaacttggtgggatagccctgccaagtatcactacgtaactgagagcattagatctcatttagaatcaaattctgatgaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

11.41

Weight (kDa)

8.8

Isoelectric Point (pI)

46.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 271
AfaI GTAC 2 cut(s) 119, 199
AfiI CCNNNNNNNGG 1 cut(s) 207
AluBI AGCT 1 cut(s) 145
AluI AGCT 1 cut(s) 145
AlwNI CAGNNNCTG 2 cut(s) 89, 145
AoxI GGCC 1 cut(s) 186
ApoI RAATTY 1 cut(s) 271
AsuHPI GGTGA 1 cut(s) 47
AsuNHI GCTAGC 1 cut(s) 52
BanII GRGCYC 1 cut(s) 49
BfaI CTAG 1 cut(s) 53
BglII AGATCT 1 cut(s) 254
BmtI GCTAGC 1 cut(s) 56
BpuEI CTTGAG 1 cut(s) 53
BsaAI YACGTR 1 cut(s) 238
Bsc4I CCNNNNNNNGG 1 cut(s) 207
Bse1I ACTGG 1 cut(s) 37
BseLI CCNNNNNNNGG 1 cut(s) 207
BseMII CTCAG 3 cut(s) 81, 141, 234
BseNI ACTGG 1 cut(s) 37
BseRI GAGGAG 1 cut(s) 53
BshFI GGCC 1 cut(s) 188
BslI CCNNNNNNNGG 1 cut(s) 207
BsnI GGCC 1 cut(s) 188
Bsp1286I GDGCHC 1 cut(s) 49
Bsp143I GATC 1 cut(s) 254
BspANI GGCC 1 cut(s) 188
BspCNI CTCAG 3 cut(s) 82, 142, 235
BspOI GCTAGC 1 cut(s) 56
BsrI ACTGG 1 cut(s) 37
BssMI GATC 1 cut(s) 254
BstBAI YACGTR 1 cut(s) 238
BstC8I GCNNGC 1 cut(s) 54
BstDEI CTNAG 3 cut(s) 90, 150, 243
BstKTI GATC 1 cut(s) 257
BstMBI GATC 1 cut(s) 254
BstMWI GCNNNNNNNGC 2 cut(s) 10, 53
BstSNI TACGTA 1 cut(s) 238
BstX2I RGATCY 1 cut(s) 254
BstXI CCANNNNNNTGG 1 cut(s) 210
BstYI RGATCY 1 cut(s) 254
BsuRI GGCC 1 cut(s) 188
BtsIMutI CAGTG 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 54
CaiI CAGNNNCTG 2 cut(s) 89, 145
Csp6I GTAC 2 cut(s) 118, 198
CviAII CATG 1 cut(s) 115
CviJI RGCY 5 cut(s) 47, 52, 145, 188, 219
CviKI_1 RGCY 5 cut(s) 47, 52, 145, 188, 219
CviQI GTAC 2 cut(s) 118, 198
DdeI CTNAG 3 cut(s) 90, 150, 243
DpnI GATC 1 cut(s) 256
DpnII GATC 1 cut(s) 254
Eco105I TACGTA 1 cut(s) 238
Eco24I GRGCYC 1 cut(s) 49
EcoT38I GRGCYC 1 cut(s) 49
FaeI CATG 1 cut(s) 118
FaiI YATR 4 cut(s) 18, 116, 165, 191
FalI AAGNNNNNCTT 2 cut(s) 62, 94
FatI CATG 1 cut(s) 114
FriOI GRGCYC 1 cut(s) 49
FspBI CTAG 1 cut(s) 53
HaeIII GGCC 1 cut(s) 188
Hin1II CATG 1 cut(s) 118
HinfI GANTC 1 cut(s) 266
HphI GGTGA 1 cut(s) 47
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 2 cut(s) 91, 277
Hpy8I GTNNAC 1 cut(s) 22
HpyAV CCTTC 3 cut(s) 123, 151, 178
HpyCH4IV ACGT 2 cut(s) 109, 237
HpyCH4V TGCA 1 cut(s) 13
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 53
HpyF3I CTNAG 3 cut(s) 90, 150, 243
HpySE526I ACGT 2 cut(s) 109, 237
Hsp92II CATG 1 cut(s) 118
Kzo9I GATC 1 cut(s) 254
LpnPI CCDG 5 cut(s) 18, 69, 152, 160, 234
MaeI CTAG 1 cut(s) 53
MaeII ACGT 2 cut(s) 109, 237
MaeIII GTNAC 1 cut(s) 238
MalI GATC 1 cut(s) 256
MboI GATC 1 cut(s) 254
MboII GAAGA 1 cut(s) 166
MflI RGATCY 1 cut(s) 254
MhlI GDGCHC 1 cut(s) 49
MluCI AATT 1 cut(s) 271
MmeI TCCRAC 1 cut(s) 159
MnlI CCTC 2 cut(s) 31, 77
MwoI GCNNNNNNNGC 2 cut(s) 10, 53
NdeII GATC 1 cut(s) 254
NheI GCTAGC 1 cut(s) 52
NlaIII CATG 1 cut(s) 118
NmeAIII GCCGAG 1 cut(s) 28
PcsI WCGNNNNNNNCGW 1 cut(s) 106
PfeI GAWTC 1 cut(s) 266
Ppu21I YACGTR 1 cut(s) 238
PsrI GAACNNNNNNTAC 2 cut(s) 155, 187
PstNI CAGNNNCTG 2 cut(s) 89, 145
PsuI RGATCY 1 cut(s) 254
RsaI GTAC 2 cut(s) 119, 199
RsaNI GTAC 2 cut(s) 118, 198
Sau3AI GATC 1 cut(s) 254
SduI GDGCHC 1 cut(s) 49
SetI ASST 6 cut(s) 69, 112, 134, 147, 162, 240
SmlI CTYRAG 1 cut(s) 68
SmoI CTYRAG 1 cut(s) 68
SnaBI TACGTA 1 cut(s) 238
Sse9I AATT 1 cut(s) 271
SspMI CTAG 1 cut(s) 53
TaiI ACGT 2 cut(s) 112, 240
TasI AATT 1 cut(s) 271
TfiI GAWTC 1 cut(s) 266
TscAI CASTG 1 cut(s) 37
TspRI CASTG 1 cut(s) 37
XapI RAATTY 1 cut(s) 271
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.