MD11G1304500.v1.1

Heat shock factor binding protein 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0005045
Physical Location & Seq
Reverse (-)
41945399 .. 41946343
945 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1304500.v1.1.491

Sequence Viewer

Length: 177 bp
ATGGACGGGCATGATTCGGAGGATCCGAAGCAGAGCACTGCTGACATGTCTGCTTTTGTGCAAAATCTTCTTCAACAAATGCAATCTAGGTTCCAAACAATGTCCGACTCCATTGTCACGAAGAATATCCTTTTCTCAGTTTCTTTAATTTCGAAAGCGCTTATTGATCCATGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04212 map04212
Pfam Domains
Protein Families
HSBP1

Protein Analysis

59

Amino Acids

6.45

Weight (kDa)

4.53

Isoelectric Point (pI)

73.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSBP1 PF06825 15 - 41 2.7e-11 Heat shock factor binding protein 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 113
AclWI GGATC 3 cut(s) 17, 30, 161
AfeI AGCGCT 1 cut(s) 159
AflIII ACRYGT 1 cut(s) 45
AgsI TTSAA 1 cut(s) 74
Alw21I GWGCWC 1 cut(s) 38
AlwI GGATC 3 cut(s) 17, 30, 161
Aor51HI AGCGCT 1 cut(s) 159
AspLEI GCGC 1 cut(s) 160
AsuII TTCGAA 1 cut(s) 152
BamHI GGATCC 1 cut(s) 22
Bbv12I GWGCWC 1 cut(s) 38
BfaI CTAG 2 cut(s) 87, 175
BfoI RGCGCY 1 cut(s) 161
BmiI GGNNCC 2 cut(s) 24, 92
Bpu14I TTCGAA 1 cut(s) 152
BseMII CTCAG 1 cut(s) 150
BsiHKAI GWGCWC 1 cut(s) 38
Bsp119I TTCGAA 1 cut(s) 152
Bsp1286I GDGCHC 1 cut(s) 38
Bsp143I GATC 2 cut(s) 22, 166
BspCNI CTCAG 1 cut(s) 149
BspLI GGNNCC 2 cut(s) 24, 92
BspPI GGATC 3 cut(s) 17, 30, 161
BspT104I TTCGAA 1 cut(s) 152
BssMI GATC 2 cut(s) 22, 166
BstBI TTCGAA 1 cut(s) 152
BstDEI CTNAG 1 cut(s) 136
BstH2I RGCGCY 1 cut(s) 161
BstHHI GCGC 1 cut(s) 160
BstKTI GATC 2 cut(s) 25, 169
BstMBI GATC 2 cut(s) 22, 166
BstNSI RCATGY 1 cut(s) 49
BstX2I RGATCY 1 cut(s) 22
BstYI RGATCY 1 cut(s) 22
BtsI GCAGTG 1 cut(s) 36
BtsIMutI CAGTG 1 cut(s) 36
CfoI GCGC 1 cut(s) 160
CviAII CATG 3 cut(s) 11, 46, 171
DdeI CTNAG 1 cut(s) 136
DpnI GATC 2 cut(s) 24, 168
DpnII GATC 2 cut(s) 22, 166
DrdI GACNNNNNNGTC 1 cut(s) 113
DseDI GACNNNNNNGTC 1 cut(s) 113
Eco47III AGCGCT 1 cut(s) 159
FaeI CATG 3 cut(s) 14, 49, 174
FaiI YATR 3 cut(s) 12, 47, 172
FatI CATG 3 cut(s) 10, 45, 170
FspBI CTAG 2 cut(s) 87, 175
FspEI CC 8 cut(s) 2, 5, 39, 73, 107, 118, 124, 143
GlaI GCGC 1 cut(s) 159
HaeII RGCGCY 1 cut(s) 161
HhaI GCGC 1 cut(s) 160
Hin1II CATG 3 cut(s) 14, 49, 174
Hin6I GCGC 1 cut(s) 158
HinP1I GCGC 1 cut(s) 158
HinfI GANTC 2 cut(s) 14, 107
Hpy188I TCNGA 3 cut(s) 19, 27, 106
Hpy188III TCNNGA 1 cut(s) 118
HpyCH4V TGCA 2 cut(s) 61, 82
HpyF3I CTNAG 1 cut(s) 136
Hsp92II CATG 3 cut(s) 14, 49, 174
HspAI GCGC 1 cut(s) 158
Kzo9I GATC 2 cut(s) 22, 166
MaeI CTAG 2 cut(s) 87, 175
MaeIII GTNAC 1 cut(s) 115
MalI GATC 2 cut(s) 24, 168
MboI GATC 2 cut(s) 22, 166
MboII GAAGA 3 cut(s) 59, 62, 133
MflI RGATCY 1 cut(s) 22
MhlI GDGCHC 1 cut(s) 38
MluCI AATT 1 cut(s) 147
MlyI GAGTC 1 cut(s) 101
MmeI TCCRAC 1 cut(s) 129
MnlI CCTC 1 cut(s) 13
MseI TTAA 1 cut(s) 146
NdeII GATC 2 cut(s) 22, 166
NlaIII CATG 3 cut(s) 14, 49, 174
NlaIV GGNNCC 2 cut(s) 24, 92
NmuCI GTSAC 1 cut(s) 115
NspI RCATGY 1 cut(s) 49
NspV TTCGAA 1 cut(s) 152
PciI ACATGT 1 cut(s) 45
PcsI WCGNNNNNNNCGW 1 cut(s) 23
PfeI GAWTC 1 cut(s) 14
PleI GAGTC 1 cut(s) 101
PpsI GAGTC 1 cut(s) 101
PscI ACATGT 1 cut(s) 45
PspN4I GGNNCC 2 cut(s) 24, 92
PsuI RGATCY 1 cut(s) 22
SaqAI TTAA 1 cut(s) 146
Sau3AI GATC 2 cut(s) 22, 166
SchI GAGTC 1 cut(s) 101
SduI GDGCHC 1 cut(s) 38
SetI ASST 1 cut(s) 92
SfuI TTCGAA 1 cut(s) 152
SgeI CNNG 5 cut(s) 19, 23, 58, 99, 130
Sse9I AATT 1 cut(s) 147
SspMI CTAG 2 cut(s) 87, 175
TaqI TCGA 1 cut(s) 152
TasI AATT 1 cut(s) 147
TfiI GAWTC 1 cut(s) 14
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
TscAI CASTG 1 cut(s) 43
TseFI GTSAC 1 cut(s) 115
Tsp45I GTSAC 1 cut(s) 115
TspRI CASTG 1 cut(s) 43
XceI RCATGY 1 cut(s) 49
XspI CTAG 2 cut(s) 87, 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.