Rmu_co8197430.1_g000001

Heat shock factor-binding protein 1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8197430.1
Physical Location & Seq
Reverse (-)
157 .. 615
459 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8197430.1_g000001.1.cds

Sequence Viewer

Length: 252 bp
atggttaatagaattgccatgggattggtggtgcttgccatgtccagacttacttttagatttgctctttcagtcgttttgctttgtatccttgaccatgatgcacttgatgagatgggcaacaggatcgaggagttagagcagagcatcaatgatctcagagccgaaatgggagtggacggcacaccatccccttcagccccttcaaagcccaaggtagataccaagtcagctgatgattcagcgaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.0

Weight (kDa)

4.75

Isoelectric Point (pI)

46.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 134
AcuI CTGAAG 1 cut(s) 180
AgsI TTSAA 1 cut(s) 207
AluBI AGCT 1 cut(s) 233
AluI AGCT 1 cut(s) 233
AlwI GGATC 1 cut(s) 134
BccI CCATC 2 cut(s) 109, 196
BceAI ACGGC 1 cut(s) 196
BcgI CGANNNNNNTGC 2 cut(s) 109, 143
BciVI GTATCC 1 cut(s) 98
BfuI GTATCC 1 cut(s) 98
BmsI GCATC 2 cut(s) 91, 156
BsaJI CCNNGG 2 cut(s) 18, 213
BseDI CCNNGG 2 cut(s) 18, 213
BseGI GGATG 1 cut(s) 188
BseMII CTCAG 1 cut(s) 172
BseRI GAGGAG 1 cut(s) 146
Bsp143I GATC 2 cut(s) 126, 154
Bsp19I CCATGG 1 cut(s) 18
BspCNI CTCAG 1 cut(s) 171
BspPI GGATC 1 cut(s) 134
BssECI CCNNGG 2 cut(s) 18, 213
BssMI GATC 2 cut(s) 126, 154
BssT1I CCWWGG 2 cut(s) 18, 213
BstC8I GCNNGC 1 cut(s) 36
BstDEI CTNAG 1 cut(s) 158
BstDSI CCRYGG 1 cut(s) 18
BstF5I GGATG 1 cut(s) 188
BstKTI GATC 2 cut(s) 129, 157
BstMBI GATC 2 cut(s) 126, 154
BstXI CCANNNNNNTGG 1 cut(s) 25
BsuI GTATCC 1 cut(s) 98
BtgI CCRYGG 1 cut(s) 18
BtsCI GGATG 1 cut(s) 188
Cac8I GCNNGC 1 cut(s) 36
CviAII CATG 3 cut(s) 19, 40, 98
CviJI RGCY 4 cut(s) 164, 200, 211, 233
CviKI_1 RGCY 4 cut(s) 164, 200, 211, 233
DdeI CTNAG 1 cut(s) 158
DpnI GATC 2 cut(s) 128, 156
DpnII GATC 2 cut(s) 126, 154
Eco130I CCWWGG 2 cut(s) 18, 213
Eco57I CTGAAG 1 cut(s) 180
EcoT14I CCWWGG 2 cut(s) 18, 213
ErhI CCWWGG 2 cut(s) 18, 213
FaeI CATG 3 cut(s) 22, 43, 101
FaiI YATR 3 cut(s) 20, 41, 99
FatI CATG 3 cut(s) 18, 39, 97
FokI GGATG 1 cut(s) 175
Hin1II CATG 3 cut(s) 22, 43, 101
HinfI GANTC 1 cut(s) 239
Hpy166II GTNNAC 1 cut(s) 178
Hpy188I TCNGA 1 cut(s) 161
Hpy188III TCNNGA 1 cut(s) 45
Hpy8I GTNNAC 1 cut(s) 178
HpyAV CCTTC 2 cut(s) 204, 213
HpyCH4V TGCA 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 158
Hsp92II CATG 3 cut(s) 22, 43, 101
Kzo9I GATC 2 cut(s) 126, 154
LpnPI CCDG 2 cut(s) 58, 109
LweI GCATC 2 cut(s) 91, 156
MalI GATC 2 cut(s) 128, 156
MboI GATC 2 cut(s) 126, 154
MluCI AATT 1 cut(s) 12
MnlI CCTC 1 cut(s) 124
MseI TTAA 1 cut(s) 6
MspA1I CMGCKG 1 cut(s) 233
NcoI CCATGG 1 cut(s) 18
NdeII GATC 2 cut(s) 126, 154
NlaIII CATG 3 cut(s) 22, 43, 101
PfeI GAWTC 1 cut(s) 239
PvuII CAGCTG 1 cut(s) 233
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 2 cut(s) 126, 154
SetI ASST 2 cut(s) 219, 235
SfaNI GCATC 2 cut(s) 91, 156
Sse9I AATT 1 cut(s) 12
StyI CCWWGG 2 cut(s) 18, 213
TaqI TCGA 1 cut(s) 129
TasI AATT 1 cut(s) 12
TfiI GAWTC 1 cut(s) 239
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
XcmI CCANNNNNNNNNTGG 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.