Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6D

Orthogroup ID

OG0005045

Physical Location & Seq

Genomic Coordinates Reverse (-)

55078447 .. 55080179

Gene Structure 1733 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6DG350000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 168 bp

ATGTCTGCTTTTGTGCAAAATCTGCTTCAACAGATGCAAACTAGGTTCCAATCGATGTCTGACAACATTGTTACAAAGAATATCCTTTTCTCTGATTCTTCAAGTTATAAGCAATCATCTTTGTATGCTAGGGTGTACATTGCCGAAGTTGTTTCACTAGTTTTATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00052 map00052

Pfam Domains

Protein Families

Glyco_transf_8

Protein Analysis

55

Amino Acids

6.28

Weight (kDa)

8.14

Isoelectric Point (pI)

87.47

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
HSBP1	PF06825	1 - 26	3.1e-10	Heat shock factor binding protein 1

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005045)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G15802
fragaria_vesca	FvH4_2g25350 FvH4_4g18020
malus_domestica	MD03G1285000.v1.1 MD11G1304500.v1.1
prunus_persica	Prupe.1G136900_v2.0.a1 Prupe.8G258100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0422221 RchiOBHm_Chr4g0422231 RchiOBHm_Chr6g0293541
rosa_laevigata	RLG00000007627 RLG00000011943
rosa_multiflora	Rmu_co8197430.1_g000001 Rmu_sc0003930.1_g000016 Rmu_sc0006269.1_g000007 Rmu_sc0014362.1_g000003 Rmu_sc0028622.1_g000002
rosa_roxburghii	Rroxscaffold_5G00364340 Rroxscaffold_7G00174100
rosa_rugosa	Rorug04G0178900 Rorug06G0236300
rosa_samantha	Rh4AG237800 Rh4BG241000 Rh4CG252900 Rh4DG236500 Rh6AG349000 Rh6BG356400 Rh6CG363100 Rh6DG350000
rosa_wichuraiana	Rw4G020580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	108
AfaI	GTAC	1 cut(s)	137
AgsI	TTSAA	2 cut(s)	29, 102
AhlI	ACTAGT	1 cut(s)	157
BcuI	ACTAGT	1 cut(s)	157
BfaI	CTAG	3 cut(s)	42, 129, 158
BmiI	GGNNCC	1 cut(s)	47
BmsI	GCATC	1 cut(s)	24
Bsa29I	ATCGAT	1 cut(s)	53
Bse3DI	GCAATG	1 cut(s)	138
BseCI	ATCGAT	1 cut(s)	53
BseMI	GCAATG	1 cut(s)	138
BshVI	ATCGAT	1 cut(s)	53
Bsp1407I	TGTACA	1 cut(s)	135
BspDI	ATCGAT	1 cut(s)	53
BspLI	GGNNCC	1 cut(s)	47
BsrDI	GCAATG	1 cut(s)	138
BsrGI	TGTACA	1 cut(s)	135
BstAPI	GCANNNNNTGC	1 cut(s)	22
BstAUI	TGTACA	1 cut(s)	135
BstMWI	GCNNNNNNNGC	1 cut(s)	22
Bsu15I	ATCGAT	1 cut(s)	53
BsuTUI	ATCGAT	1 cut(s)	53
ClaI	ATCGAT	1 cut(s)	53
Csp6I	GTAC	1 cut(s)	136
CviQI	GTAC	1 cut(s)	136
FaiI	YATR	3 cut(s)	108, 126, 166
FspBI	CTAG	3 cut(s)	42, 129, 158
FspEI	CC	6 cut(s)	28, 62, 98, 115, 116, 157
HinfI	GANTC	1 cut(s)	95
Hpy166II	GTNNAC	1 cut(s)	136
Hpy188I	TCNGA	2 cut(s)	61, 94
Hpy8I	GTNNAC	1 cut(s)	136
HpyCH4V	TGCA	2 cut(s)	16, 37
HpyF10VI	GCNNNNNNNGC	1 cut(s)	22
LweI	GCATC	1 cut(s)	24
MaeI	CTAG	3 cut(s)	42, 129, 158
MaeIII	GTNAC	1 cut(s)	70
MboII	GAAGA	1 cut(s)	90
MwoI	GCNNNNNNNGC	1 cut(s)	22
NlaIV	GGNNCC	1 cut(s)	47
PfeI	GAWTC	1 cut(s)	95
PsiI	TTATAA	1 cut(s)	108
PspN4I	GGNNCC	1 cut(s)	47
RsaI	GTAC	1 cut(s)	137
RsaNI	GTAC	1 cut(s)	136
SetI	ASST	1 cut(s)	47
SfaNI	GCATC	1 cut(s)	24
SgeI	CNNG	3 cut(s)	54, 114, 141
SpeI	ACTAGT	1 cut(s)	157
SspMI	CTAG	3 cut(s)	42, 129, 158
TaqI	TCGA	1 cut(s)	53
TatI	WGTACW	1 cut(s)	135
TfiI	GAWTC	1 cut(s)	95
XspI	CTAG	3 cut(s)	42, 129, 158

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.