Rh6CG363100

Heat shock factor-binding protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0005045
Physical Location & Seq
Reverse (-)
55168961 .. 55170682
1722 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG363100.1

Sequence Viewer

Length: 270 bp
ATGGACGGGCACGATTCGGAGGATTCGAAGCAGAGCACTGCTGATATGTCTGCTTTTGTGCAAAATCTGCTTCAACAGATGCAAACTAGGTTCCAATCGATGTCTGACAACATTGTTACAAAGATTGATGAGATGGGAAACCGCATTAACGAGTTGGAACGTAGCATCGGTGACCTAAGAACAGAGATGGGAATCGAAGGCTCTCCATCTCCCGCCCCCCAGTCCAAGTCTGATGAAGATGGAGGGAAGCAAGATGAAGGTTCAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04212 map04212
Pfam Domains
Protein Families
HSBP1

Protein Analysis

89

Amino Acids

9.74

Weight (kDa)

4.24

Isoelectric Point (pI)

90.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSBP1 PF06825 15 - 62 1.5e-23 Heat shock factor binding protein 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 142, 213
AgsI TTSAA 1 cut(s) 74
Alw21I GWGCWC 1 cut(s) 38
AsuHPI GGTGA 1 cut(s) 182
AsuII TTCGAA 1 cut(s) 26
BaeGI GKGCMC 1 cut(s) 12
Bbv12I GWGCWC 1 cut(s) 38
BccI CCATC 4 cut(s) 127, 181, 214, 233
BfaI CTAG 1 cut(s) 87
BmiI GGNNCC 1 cut(s) 92
BmrI ACTGGG 1 cut(s) 214
BmsI GCATC 2 cut(s) 69, 174
BmuI ACTGGG 1 cut(s) 214
Bpu14I TTCGAA 1 cut(s) 26
Bsa29I ATCGAT 1 cut(s) 98
BsaBI GATNNNNATC 1 cut(s) 191
Bse1I ACTGG 1 cut(s) 220
Bse8I GATNNNNATC 1 cut(s) 191
BseCI ATCGAT 1 cut(s) 98
BseJI GATNNNNATC 1 cut(s) 191
BseNI ACTGG 1 cut(s) 220
BseSI GKGCMC 1 cut(s) 12
BshVI ATCGAT 1 cut(s) 98
BsiHKAI GWGCWC 1 cut(s) 38
Bsp119I TTCGAA 1 cut(s) 26
Bsp1286I GDGCHC 2 cut(s) 12, 38
BspACI CCGC 2 cut(s) 142, 213
BspDI ATCGAT 1 cut(s) 98
BspLI GGNNCC 1 cut(s) 92
BspT104I TTCGAA 1 cut(s) 26
BsrI ACTGG 1 cut(s) 220
BstAPI GCANNNNNTGC 1 cut(s) 67
BstBI TTCGAA 1 cut(s) 26
BstDEI CTNAG 1 cut(s) 176
BstEII GGTNACC 1 cut(s) 170
BstMWI GCNNNNNNNGC 1 cut(s) 67
BstPI GGTNACC 1 cut(s) 170
BstSLI GKGCMC 1 cut(s) 12
Bsu15I ATCGAT 1 cut(s) 98
BsuTUI ATCGAT 1 cut(s) 98
BtsI GCAGTG 1 cut(s) 36
BtsIMutI CAGTG 1 cut(s) 36
ClaI ATCGAT 1 cut(s) 98
CviAII CATG 1 cut(s) 267
CviJI RGCY 1 cut(s) 201
CviKI_1 RGCY 1 cut(s) 201
DdeI CTNAG 1 cut(s) 176
Eco91I GGTNACC 1 cut(s) 170
EcoO65I GGTNACC 1 cut(s) 170
FaeI CATG 1 cut(s) 270
FaiI YATR 2 cut(s) 47, 268
FatI CATG 1 cut(s) 266
FauI CCCGC 1 cut(s) 220
FspBI CTAG 1 cut(s) 87
Hin1II CATG 1 cut(s) 270
HinfI GANTC 3 cut(s) 14, 23, 192
HphI GGTGA 1 cut(s) 182
Hpy188I TCNGA 3 cut(s) 19, 106, 232
HpyAV CCTTC 2 cut(s) 191, 251
HpyCH4IV ACGT 1 cut(s) 160
HpyCH4V TGCA 2 cut(s) 61, 82
HpyF10VI GCNNNNNNNGC 1 cut(s) 67
HpyF3I CTNAG 1 cut(s) 176
HpySE526I ACGT 1 cut(s) 160
Hsp92II CATG 1 cut(s) 270
LpnPI CCDG 1 cut(s) 233
LweI GCATC 2 cut(s) 69, 174
MaeI CTAG 1 cut(s) 87
MaeII ACGT 1 cut(s) 160
MaeIII GTNAC 2 cut(s) 115, 170
MboII GAAGA 1 cut(s) 248
MhlI GDGCHC 2 cut(s) 12, 38
MmeI TCCRAC 1 cut(s) 135
MnlI CCTC 2 cut(s) 13, 236
MseI TTAA 1 cut(s) 147
MwoI GCNNNNNNNGC 1 cut(s) 67
NlaIII CATG 1 cut(s) 270
NlaIV GGNNCC 1 cut(s) 92
NmuCI GTSAC 1 cut(s) 170
NspV TTCGAA 1 cut(s) 26
PcsI WCGNNNNNNNCGW 1 cut(s) 23
PfeI GAWTC 3 cut(s) 14, 23, 192
PspEI GGTNACC 1 cut(s) 170
PspN4I GGNNCC 1 cut(s) 92
SaqAI TTAA 1 cut(s) 147
SduI GDGCHC 2 cut(s) 12, 38
SetI ASST 4 cut(s) 92, 163, 177, 262
SfaNI GCATC 2 cut(s) 69, 174
SfuI TTCGAA 1 cut(s) 26
SgeI CNNG 8 cut(s) 19, 23, 99, 163, 224, 232, 238, 263
SsiI CCGC 2 cut(s) 142, 213
SspMI CTAG 1 cut(s) 87
TaiI ACGT 1 cut(s) 163
TaqI TCGA 3 cut(s) 26, 98, 195
TfiI GAWTC 3 cut(s) 14, 23, 192
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 1 cut(s) 43
TseFI GTSAC 1 cut(s) 170
Tsp45I GTSAC 1 cut(s) 170
TspDTI ATGAA 2 cut(s) 249, 270
TspRI CASTG 1 cut(s) 43
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.