MD13G1080800.v1.1

Belongs to the thioredoxin family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Forward (+)
5690635 .. 5692547
1913 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1080800.v1.1.491

Sequence Viewer

Length: 390 bp
ATGGGAGGTAACACGTCACACTTTGAAGACTCGGATGAATCTCCACTTGAACACATGTCTCGCATCGTGGCCTTCCATTCCCAGGACCAATGGAACACCCACTTTGCTGCCGTCAAAGACAGCAATAAACTGATGGTGATTGATTTCACGGCTAAATGGTGTGGACCTTGTAGAGCCATGGAACCAATCTTCAGAGAGTACGCTAATAAATTCACCGACGTTGAGTTCGTCAAGCTTGATGTCGACGAGCTATCGGATGTGGCAGTGGAGTTTAGTGTGGAGGCAATGCCTTCATTTGTGTTCGTGAAGAATGGGGAGGTGGTTGATAAGGTCGTGGGGGCCAGGAAAGATGAACTGCAGAAGAAGATTGAGAAACACAGGAAATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

130

Amino Acids

14.76

Weight (kDa)

5.33

Isoelectric Point (pI)

31.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Thioredoxin PF00085 33 - 125 3e-29 Thioredoxin
Thioredoxin_2 PF13098 39 - 120 8.1e-06 Thioredoxin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 243
AcsI RAATTY 1 cut(s) 209
AcuI CTGAAG 1 cut(s) 175
AfaI GTAC 1 cut(s) 200
AfiI CCNNNNNNNGG 1 cut(s) 82
AflIII ACRYGT 2 cut(s) 12, 54
AgsI TTSAA 2 cut(s) 26, 50
AjiI CACGTC 1 cut(s) 15
AjnI CCWGG 2 cut(s) 81, 341
AluBI AGCT 2 cut(s) 235, 250
AluI AGCT 2 cut(s) 235, 250
Alw26I GTCTC 1 cut(s) 63
AoxI GGCC 2 cut(s) 69, 339
ApeKI GCWGC 1 cut(s) 107
ApoI RAATTY 1 cut(s) 209
ArsI GACNNNNNNTTYG 2 cut(s) 209, 241
AspS9I GGNCC 3 cut(s) 85, 164, 339
AsuHPI GGTGA 2 cut(s) 148, 205
AvaII GGWCC 2 cut(s) 85, 164
BbsI GAAGAC 1 cut(s) 33
BbvI GCAGC 1 cut(s) 94
BccI CCATC 1 cut(s) 127
BceAI ACGGC 2 cut(s) 95, 165
BciT130I CCWGG 2 cut(s) 83, 343
BcoDI GTCTC 1 cut(s) 63
BfmI CTRYAG 1 cut(s) 356
BisI GCNGC 1 cut(s) 108
BlsI GCNGC 1 cut(s) 109
Bme1390I CCNGG 2 cut(s) 83, 343
Bme18I GGWCC 2 cut(s) 85, 164
BmgBI CACGTC 1 cut(s) 15
BmgT120I GGNCC 3 cut(s) 85, 164, 339
BmiI GGNNCC 2 cut(s) 183, 340
BmrFI CCNGG 2 cut(s) 83, 343
BmsI GCATC 1 cut(s) 72
BpiI GAAGAC 1 cut(s) 33
BsaJI CCNNGG 2 cut(s) 81, 177
Bsc4I CCNNNNNNNGG 1 cut(s) 82
Bse3DI GCAATG 1 cut(s) 291
BseBI CCWGG 2 cut(s) 83, 343
BseDI CCNNGG 2 cut(s) 81, 177
BseGI GGATG 2 cut(s) 40, 262
BseLI CCNNNNNNNGG 1 cut(s) 82
BseMI GCAATG 1 cut(s) 291
BseXI GCAGC 1 cut(s) 94
BshFI GGCC 2 cut(s) 71, 341
BslI CCNNNNNNNGG 1 cut(s) 82
BsmAI GTCTC 1 cut(s) 63
BsnI GGCC 2 cut(s) 71, 341
Bsp19I CCATGG 1 cut(s) 177
BspANI GGCC 2 cut(s) 71, 341
BspLI GGNNCC 2 cut(s) 183, 340
BspMAI CTGCAG 1 cut(s) 360
BsrDI GCAATG 1 cut(s) 291
BssECI CCNNGG 2 cut(s) 81, 177
BssT1I CCWWGG 1 cut(s) 177
Bst2UI CCWGG 2 cut(s) 83, 343
BstDSI CCRYGG 1 cut(s) 177
BstF5I GGATG 2 cut(s) 40, 262
BstMAI GTCTC 1 cut(s) 63
BstNI CCWGG 2 cut(s) 83, 343
BstNSI RCATGY 1 cut(s) 58
BstSCI CCNGG 2 cut(s) 81, 341
BstSFI CTRYAG 1 cut(s) 356
BstV1I GCAGC 1 cut(s) 94
BstV2I GAAGAC 1 cut(s) 33
BsuRI GGCC 2 cut(s) 71, 341
BtgI CCRYGG 1 cut(s) 177
BtrI CACGTC 1 cut(s) 15
BtsCI GGATG 2 cut(s) 40, 262
BtsI GCAGTG 1 cut(s) 270
BtsIMutI CAGTG 1 cut(s) 270
Cfr13I GGNCC 3 cut(s) 85, 164, 339
Csp6I GTAC 1 cut(s) 199
CviAII CATG 2 cut(s) 55, 178
CviJI RGCY 6 cut(s) 71, 152, 176, 235, 250, 341
CviKI_1 RGCY 6 cut(s) 71, 152, 176, 235, 250, 341
CviQI GTAC 1 cut(s) 199
Eco130I CCWWGG 1 cut(s) 177
Eco47I GGWCC 2 cut(s) 85, 164
Eco57I CTGAAG 1 cut(s) 175
EcoRII CCWGG 2 cut(s) 81, 341
EcoT14I CCWWGG 1 cut(s) 177
ErhI CCWWGG 1 cut(s) 177
FaeI CATG 2 cut(s) 58, 181
FaiI YATR 3 cut(s) 56, 179, 388
FatI CATG 2 cut(s) 54, 177
FblI GTMKAC 1 cut(s) 243
Fnu4HI GCNGC 1 cut(s) 108
FokI GGATG 2 cut(s) 47, 269
Fsp4HI GCNGC 1 cut(s) 108
GluI GCNGC 1 cut(s) 108
HaeIII GGCC 2 cut(s) 71, 341
Hin1II CATG 2 cut(s) 58, 181
HincII GTYRAC 1 cut(s) 244
HindII GTYRAC 1 cut(s) 244
HindIII AAGCTT 1 cut(s) 233
HinfI GANTC 2 cut(s) 29, 38
HphI GGTGA 2 cut(s) 148, 205
Hpy166II GTNNAC 2 cut(s) 164, 244
Hpy188I TCNGA 3 cut(s) 34, 194, 256
Hpy188III TCNNGA 1 cut(s) 304
Hpy8I GTNNAC 2 cut(s) 164, 244
Hpy99I CGWCG 2 cut(s) 221, 248
HpyAV CCTTC 2 cut(s) 82, 300
HpyCH4IV ACGT 2 cut(s) 14, 219
HpyCH4V TGCA 1 cut(s) 358
HpySE526I ACGT 2 cut(s) 14, 219
Hsp92II CATG 2 cut(s) 58, 181
LpnPI CCDG 5 cut(s) 68, 95, 328, 355, 364
Lsp1109I GCAGC 1 cut(s) 94
LweI GCATC 1 cut(s) 72
MaeII ACGT 2 cut(s) 14, 219
MaeIII GTNAC 2 cut(s) 8, 15
MboII GAAGA 5 cut(s) 38, 181, 319, 373, 376
MluCI AATT 1 cut(s) 209
MlyI GAGTC 1 cut(s) 23
MnlI CCTC 2 cut(s) 274, 310
MspR9I CCNGG 2 cut(s) 83, 343
MvaI CCWGG 2 cut(s) 83, 343
NcoI CCATGG 1 cut(s) 177
NlaIII CATG 2 cut(s) 58, 181
NlaIV GGNNCC 2 cut(s) 183, 340
NmuCI GTSAC 1 cut(s) 15
NspI RCATGY 1 cut(s) 58
PciI ACATGT 1 cut(s) 54
PcsI WCGNNNNNNNCGW 1 cut(s) 225
PfeI GAWTC 1 cut(s) 38
PkrI GCNGC 1 cut(s) 109
PleI GAGTC 1 cut(s) 23
PpsI GAGTC 1 cut(s) 23
PscI ACATGT 1 cut(s) 54
Psp6I CCWGG 2 cut(s) 81, 341
PspGI CCWGG 2 cut(s) 81, 341
PspN4I GGNNCC 2 cut(s) 183, 340
PspPI GGNCC 3 cut(s) 85, 164, 339
PstI CTGCAG 1 cut(s) 360
RsaI GTAC 1 cut(s) 200
RsaNI GTAC 1 cut(s) 199
SalI GTCGAC 1 cut(s) 242
SatI GCNGC 1 cut(s) 108
Sau96I GGNCC 3 cut(s) 85, 164, 339
SchI GAGTC 1 cut(s) 23
ScrFI CCNGG 2 cut(s) 83, 343
SetI ASST 8 cut(s) 10, 17, 169, 222, 237, 252, 321, 333
SfaNI GCATC 1 cut(s) 72
SfcI CTRYAG 1 cut(s) 356
SinI GGWCC 2 cut(s) 85, 164
Sse9I AATT 1 cut(s) 209
StyD4I CCNGG 2 cut(s) 81, 341
StyI CCWWGG 1 cut(s) 177
TaiI ACGT 2 cut(s) 17, 222
TaqI TCGA 1 cut(s) 243
TasI AATT 1 cut(s) 209
TfiI GAWTC 1 cut(s) 38
TscAI CASTG 1 cut(s) 270
TseFI GTSAC 1 cut(s) 15
TseI GCWGC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 15
TspDTI ATGAA 3 cut(s) 51, 282, 366
TspRI CASTG 1 cut(s) 270
VpaK11BI GGWCC 2 cut(s) 85, 164
XapI RAATTY 1 cut(s) 209
XceI RCATGY 1 cut(s) 58
XmiI GTMKAC 1 cut(s) 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.