MD13G1081100.v1.1

Belongs to the thioredoxin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0002536
Physical Location & Seq
Forward (+)
5710516 .. 5711262
747 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1081100.v1.1.491

Sequence Viewer

Length: 213 bp
ATGGAGCCAATTTTCAGAGAGTACGCTGATAAATTCACCGACATTGAGTTCGTCAAGCTTGATGTCGACGAGCTACCGGATGTGTCAATGGAGTTTAGTGTGCAGGCAATGCCTTCATTTGTATTCGTGAAGAAAGGGGAGGTGGTTGATAAGATCGTGGGGGCCAGGAAAGATGAACTGCAGAAGAAGATTGAGAAACACAGGAGATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04621 ko05418 map04621 map05418
Pfam Domains
Protein Families
Thioredoxin

Protein Analysis

71

Amino Acids

8.22

Weight (kDa)

5.36

Isoelectric Point (pI)

40.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Thioredoxin PF00085 1 - 66 3.3e-14 Thioredoxin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 66
AcsI RAATTY 1 cut(s) 32
AfaI GTAC 1 cut(s) 23
AjnI CCWGG 1 cut(s) 164
AluBI AGCT 2 cut(s) 58, 73
AluI AGCT 2 cut(s) 58, 73
AoxI GGCC 1 cut(s) 162
ApoI RAATTY 1 cut(s) 32
ArsI GACNNNNNNTTYG 2 cut(s) 32, 64
AspS9I GGNCC 1 cut(s) 162
AsuHPI GGTGA 1 cut(s) 28
BciT130I CCWGG 1 cut(s) 166
BfmI CTRYAG 1 cut(s) 179
Bme1390I CCNGG 1 cut(s) 166
BmgT120I GGNCC 1 cut(s) 162
BmiI GGNNCC 2 cut(s) 6, 163
BmrFI CCNGG 1 cut(s) 166
BsaWI WCCGGW 1 cut(s) 76
Bse3DI GCAATG 1 cut(s) 114
BseBI CCWGG 1 cut(s) 166
BseGI GGATG 1 cut(s) 85
BseMI GCAATG 1 cut(s) 114
BsgI GTGCAG 1 cut(s) 122
BshFI GGCC 1 cut(s) 164
BsiSI CCGG 1 cut(s) 77
BsnI GGCC 1 cut(s) 164
Bsp143I GATC 2 cut(s) 153, 206
BspANI GGCC 1 cut(s) 164
BspLI GGNNCC 2 cut(s) 6, 163
BspMAI CTGCAG 1 cut(s) 183
BsrDI GCAATG 1 cut(s) 114
BssMI GATC 2 cut(s) 153, 206
Bst2UI CCWGG 1 cut(s) 166
BstAPI GCANNNNNTGC 1 cut(s) 109
BstC8I GCNNGC 1 cut(s) 105
BstF5I GGATG 1 cut(s) 85
BstKTI GATC 2 cut(s) 156, 209
BstMBI GATC 2 cut(s) 153, 206
BstMWI GCNNNNNNNGC 1 cut(s) 109
BstNI CCWGG 1 cut(s) 166
BstSCI CCNGG 1 cut(s) 164
BstSFI CTRYAG 1 cut(s) 179
BsuRI GGCC 1 cut(s) 164
BtsCI GGATG 1 cut(s) 85
Cac8I GCNNGC 1 cut(s) 105
Cfr13I GGNCC 1 cut(s) 162
Csp6I GTAC 1 cut(s) 22
CviJI RGCY 4 cut(s) 7, 58, 73, 164
CviKI_1 RGCY 4 cut(s) 7, 58, 73, 164
CviQI GTAC 1 cut(s) 22
DpnI GATC 2 cut(s) 155, 208
DpnII GATC 2 cut(s) 153, 206
EcoRII CCWGG 1 cut(s) 164
FaiI YATR 1 cut(s) 211
FblI GTMKAC 1 cut(s) 66
FokI GGATG 1 cut(s) 92
HaeIII GGCC 1 cut(s) 164
HapII CCGG 1 cut(s) 77
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
HindIII AAGCTT 1 cut(s) 56
HpaII CCGG 1 cut(s) 77
HphI GGTGA 1 cut(s) 28
Hpy166II GTNNAC 1 cut(s) 67
Hpy188I TCNGA 1 cut(s) 17
Hpy188III TCNNGA 1 cut(s) 127
Hpy8I GTNNAC 1 cut(s) 67
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 123
HpyCH4V TGCA 2 cut(s) 103, 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 109
Kzo9I GATC 2 cut(s) 153, 206
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 5 cut(s) 89, 90, 151, 178, 187
MalI GATC 2 cut(s) 155, 208
MboI GATC 2 cut(s) 153, 206
MboII GAAGA 3 cut(s) 142, 196, 199
MluCI AATT 2 cut(s) 9, 32
MnlI CCTC 1 cut(s) 133
MspI CCGG 1 cut(s) 77
MspR9I CCNGG 1 cut(s) 166
MvaI CCWGG 1 cut(s) 166
MwoI GCNNNNNNNGC 1 cut(s) 109
NdeII GATC 2 cut(s) 153, 206
NlaIV GGNNCC 2 cut(s) 6, 163
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
PspN4I GGNNCC 2 cut(s) 6, 163
PspPI GGNCC 1 cut(s) 162
PstI CTGCAG 1 cut(s) 183
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
SalI GTCGAC 1 cut(s) 65
Sau3AI GATC 2 cut(s) 153, 206
Sau96I GGNCC 1 cut(s) 162
ScrFI CCNGG 1 cut(s) 166
SetI ASST 3 cut(s) 60, 75, 144
SfcI CTRYAG 1 cut(s) 179
SgeI CNNG 9 cut(s) 67, 71, 82, 89, 116, 139, 169, 177, 178
Sse9I AATT 2 cut(s) 9, 32
StyD4I CCNGG 1 cut(s) 164
TaqI TCGA 1 cut(s) 66
TasI AATT 2 cut(s) 9, 32
TspDTI ATGAA 2 cut(s) 105, 189
XapI RAATTY 1 cut(s) 32
XmiI GTMKAC 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.