MD16G1151900.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
OG0004229
Physical Location & Seq
Forward (+)
11999274 .. 11999812
539 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1151900.v1.1.491

Sequence Viewer

Length: 318 bp
ATGAGGACCTTGCTCATAACATGTGTTGCCTTTGCCTTGATCTTGGCATTTCTTCAAGCTGATGCTAAAAGGCTCACTCCAAATGAACGTCACCTGCTGGCTTCACTTAAAAATGATCAAAATCAGGTCCGGAGCACTGCCGTTGTCGCTGACGGCAATGCGAAGAATCAACCTCAGTCTCAGACCGCAAACAACAACGAGGCTAAACTTGACGAGGATGACGGTGATGCCAATGAGAGTTATGGTCAGTATGGAAATGCTCCTACCGGAAATGATTCCCACCGTTATTTTCCCGACGATAAATTTCACCACCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

11.64

Weight (kDa)

5.4

Isoelectric Point (pI)

28.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 102
Acc36I ACCTGC 1 cut(s) 102
AccIII TCCGGA 1 cut(s) 129
AciI CCGC 1 cut(s) 186
AcsI RAATTY 1 cut(s) 302
AflIII ACRYGT 1 cut(s) 20
AgsI TTSAA 1 cut(s) 56
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
Alw21I GWGCWC 1 cut(s) 137
Alw26I GTCTC 1 cut(s) 183
Aor13HI TCCGGA 1 cut(s) 129
ApoI RAATTY 1 cut(s) 302
Asp700I GAANNNNTTC 1 cut(s) 274
AspS9I GGNCC 2 cut(s) 6, 127
AsuHPI GGTGA 3 cut(s) 83, 236, 299
AvaII GGWCC 2 cut(s) 6, 127
Bbv12I GWGCWC 1 cut(s) 137
BceAI ACGGC 2 cut(s) 125, 169
BclI TGATCA 1 cut(s) 115
BcoDI GTCTC 1 cut(s) 183
BfuAI ACCTGC 1 cut(s) 102
Bme18I GGWCC 2 cut(s) 6, 127
BmgT120I GGNCC 2 cut(s) 6, 127
BmsI GCATC 2 cut(s) 52, 217
BsaBI GATNNNNATC 1 cut(s) 120
BsaWI WCCGGW 2 cut(s) 129, 266
Bse3DI GCAATG 1 cut(s) 163
Bse8I GATNNNNATC 1 cut(s) 120
BseAI TCCGGA 1 cut(s) 129
BseGI GGATG 1 cut(s) 223
BseJI GATNNNNATC 1 cut(s) 120
BseMI GCAATG 1 cut(s) 163
BseMII CTCAG 2 cut(s) 188, 194
BsiHKAI GWGCWC 1 cut(s) 137
BsiSI CCGG 2 cut(s) 130, 267
BsmAI GTCTC 1 cut(s) 183
Bsp1286I GDGCHC 1 cut(s) 137
Bsp13I TCCGGA 1 cut(s) 129
Bsp143I GATC 2 cut(s) 39, 115
BspACI CCGC 1 cut(s) 186
BspCNI CTCAG 2 cut(s) 187, 193
BspEI TCCGGA 1 cut(s) 129
BspMI ACCTGC 1 cut(s) 102
BsrDI GCAATG 1 cut(s) 163
BssMI GATC 2 cut(s) 39, 115
Bst4CI ACNGT 2 cut(s) 224, 284
BstC8I GCNNGC 1 cut(s) 99
BstDEI CTNAG 2 cut(s) 174, 180
BstF5I GGATG 1 cut(s) 223
BstKTI GATC 2 cut(s) 42, 118
BstMAI GTCTC 1 cut(s) 183
BstMBI GATC 2 cut(s) 39, 115
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstNSI RCATGY 1 cut(s) 24
BtsCI GGATG 1 cut(s) 223
BtsI GCAGTG 1 cut(s) 135
BtsIMutI CAGTG 1 cut(s) 135
BveI ACCTGC 1 cut(s) 102
Cac8I GCNNGC 1 cut(s) 99
Cfr13I GGNCC 2 cut(s) 6, 127
CviAII CATG 1 cut(s) 21
CviJI RGCY 4 cut(s) 59, 73, 101, 203
CviKI_1 RGCY 4 cut(s) 59, 73, 101, 203
DdeI CTNAG 2 cut(s) 174, 180
DpnI GATC 2 cut(s) 41, 117
DpnII GATC 2 cut(s) 39, 115
Eco47I GGWCC 2 cut(s) 6, 127
EcoO109I RGGNCCY 1 cut(s) 6
FaeI CATG 1 cut(s) 24
FaiI YATR 4 cut(s) 17, 22, 243, 252
FatI CATG 1 cut(s) 20
FbaI TGATCA 1 cut(s) 115
FokI GGATG 1 cut(s) 230
HapII CCGG 2 cut(s) 130, 267
Hin1II CATG 1 cut(s) 24
HinfI GANTC 2 cut(s) 166, 275
HpaII CCGG 2 cut(s) 130, 267
HphI GGTGA 3 cut(s) 83, 236, 299
Hpy188I TCNGA 1 cut(s) 183
Hpy188III TCNNGA 2 cut(s) 130, 293
Hpy99I CGWCG 1 cut(s) 299
HpyCH4III ACNGT 2 cut(s) 224, 284
HpyCH4IV ACGT 1 cut(s) 88
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 2 cut(s) 174, 180
HpySE526I ACGT 1 cut(s) 88
Hsp92II CATG 1 cut(s) 24
Kpn2I TCCGGA 1 cut(s) 129
Ksp22I TGATCA 1 cut(s) 115
Kzo9I GATC 2 cut(s) 39, 115
LmnI GCTCC 2 cut(s) 132, 265
LpnPI CCDG 5 cut(s) 83, 107, 110, 143, 280
LweI GCATC 2 cut(s) 52, 217
MaeII ACGT 1 cut(s) 88
MaeIII GTNAC 1 cut(s) 89
MalI GATC 2 cut(s) 41, 117
MboI GATC 2 cut(s) 39, 115
MboII GAAGA 2 cut(s) 44, 175
MhlI GDGCHC 1 cut(s) 137
MluCI AATT 1 cut(s) 302
MnlI CCTC 3 cut(s) 183, 193, 208
MroI TCCGGA 1 cut(s) 129
MroXI GAANNNNTTC 1 cut(s) 274
MseI TTAA 1 cut(s) 108
MspI CCGG 2 cut(s) 130, 267
MwoI GCNNNNNNNGC 1 cut(s) 146
NdeII GATC 2 cut(s) 39, 115
NlaIII CATG 1 cut(s) 24
NmuCI GTSAC 1 cut(s) 89
NspI RCATGY 1 cut(s) 24
PaqCI CACCTGC 1 cut(s) 102
PciI ACATGT 1 cut(s) 20
PdmI GAANNNNTTC 1 cut(s) 274
PfeI GAWTC 2 cut(s) 166, 275
PpuMI RGGWCCY 1 cut(s) 6
PscI ACATGT 1 cut(s) 20
Psp5II RGGWCCY 1 cut(s) 6
PspPI GGNCC 2 cut(s) 6, 127
PspPPI RGGWCCY 1 cut(s) 6
SaqAI TTAA 1 cut(s) 108
Sau3AI GATC 2 cut(s) 39, 115
Sau96I GGNCC 2 cut(s) 6, 127
SduI GDGCHC 1 cut(s) 137
SetI ASST 6 cut(s) 11, 61, 91, 96, 129, 175
SfaNI GCATC 2 cut(s) 52, 217
SinI GGWCC 2 cut(s) 6, 127
Sse9I AATT 1 cut(s) 302
SsiI CCGC 1 cut(s) 186
TaaI ACNGT 2 cut(s) 224, 284
TaiI ACGT 1 cut(s) 91
TasI AATT 1 cut(s) 302
TfiI GAWTC 2 cut(s) 166, 275
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TscAI CASTG 1 cut(s) 142
TseFI GTSAC 1 cut(s) 89
Tsp45I GTSAC 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 99
TspRI CASTG 1 cut(s) 142
VpaK11BI GGWCC 2 cut(s) 6, 127
XapI RAATTY 1 cut(s) 302
XceI RCATGY 1 cut(s) 24
XmnI GAANNNNTTC 1 cut(s) 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.