Prupe.1G115400_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
9123630 .. 9124455
826 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G115400.1

Sequence Viewer

Length: 291 bp
ATGAGGACCTTACTTGTACTATGTGTTGCCTTTTCCTTGATCTTGGCTTTTTTGCAAGCTGATGCTAAAAGGTACAATTTGCATCAACGTCACCTGGCTCAGCAGAAAAATGATTCAAATCTGCATGCTAGTGACACAAAGGATCAATCTCAGCCTGCAACCACAAACAACAACGAGGCCAAGCATGATGACGACGATGATGCCAACGAGAGTTATGGTAAATTCGGACATGATTCTTCTGAAAGTGATTCTCACCGTTATTTTGTCGATGATCAATTTCACCCCCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.98

Weight (kDa)

5.44

Isoelectric Point (pI)

35.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 150
AcsI RAATTY 1 cut(s) 221
AfaI GTAC 2 cut(s) 18, 74
AgsI TTSAA 1 cut(s) 117
AjnI CCWGG 1 cut(s) 93
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
AlwI GGATC 1 cut(s) 150
AoxI GGCC 1 cut(s) 177
ApoI RAATTY 1 cut(s) 221
AspS9I GGNCC 1 cut(s) 6
AsuHPI GGTGA 3 cut(s) 83, 245, 272
AvaII GGWCC 1 cut(s) 6
BcgI CGANNNNNNTGC 2 cut(s) 182, 216
BciT130I CCWGG 1 cut(s) 95
BclI TGATCA 1 cut(s) 271
BfaI CTAG 1 cut(s) 129
BlpI GCTNAGC 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 95
Bme18I GGWCC 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 95
BmsI GCATC 3 cut(s) 52, 91, 190
Bpu1102I GCTNAGC 1 cut(s) 99
BsaBI GATNNNNATC 1 cut(s) 117
Bse8I GATNNNNATC 1 cut(s) 117
BseBI CCWGG 1 cut(s) 95
BseJI GATNNNNATC 1 cut(s) 117
BseMII CTCAG 2 cut(s) 113, 164
BshFI GGCC 1 cut(s) 179
BsnI GGCC 1 cut(s) 179
Bsp143I GATC 3 cut(s) 39, 142, 271
Bsp1720I GCTNAGC 1 cut(s) 99
BspANI GGCC 1 cut(s) 179
BspCNI CTCAG 2 cut(s) 112, 163
BspPI GGATC 1 cut(s) 150
BssMI GATC 3 cut(s) 39, 142, 271
Bst2UI CCWGG 1 cut(s) 95
Bst4CI ACNGT 1 cut(s) 257
BstC8I GCNNGC 3 cut(s) 57, 126, 156
BstDEI CTNAG 2 cut(s) 99, 150
BstKTI GATC 3 cut(s) 42, 145, 274
BstMBI GATC 3 cut(s) 39, 142, 271
BstNI CCWGG 1 cut(s) 95
BstNSI RCATGY 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 93
BsuRI GGCC 1 cut(s) 179
Cac8I GCNNGC 3 cut(s) 57, 126, 156
Cfr13I GGNCC 1 cut(s) 6
Csp6I GTAC 2 cut(s) 17, 73
CviAII CATG 3 cut(s) 125, 185, 230
CviJI RGCY 5 cut(s) 47, 59, 98, 154, 179
CviKI_1 RGCY 5 cut(s) 47, 59, 98, 154, 179
CviQI GTAC 2 cut(s) 17, 73
DdeI CTNAG 2 cut(s) 99, 150
DpnI GATC 3 cut(s) 41, 144, 273
DpnII GATC 3 cut(s) 39, 142, 271
Eco47I GGWCC 1 cut(s) 6
EcoO109I RGGNCCY 1 cut(s) 6
EcoRII CCWGG 1 cut(s) 93
FaeI CATG 3 cut(s) 128, 188, 233
FaiI YATR 5 cut(s) 22, 126, 186, 216, 231
FatI CATG 3 cut(s) 124, 184, 229
FbaI TGATCA 1 cut(s) 271
FspBI CTAG 1 cut(s) 129
HaeIII GGCC 1 cut(s) 179
Hin1II CATG 3 cut(s) 128, 188, 233
HinfI GANTC 3 cut(s) 113, 233, 248
HphI GGTGA 3 cut(s) 83, 245, 272
Hpy188I TCNGA 2 cut(s) 227, 241
Hpy99I CGWCG 1 cut(s) 197
HpyCH4III ACNGT 1 cut(s) 257
HpyCH4IV ACGT 1 cut(s) 88
HpyCH4V TGCA 4 cut(s) 55, 82, 124, 158
HpyF3I CTNAG 2 cut(s) 99, 150
HpySE526I ACGT 1 cut(s) 88
Hsp92II CATG 3 cut(s) 128, 188, 233
Ksp22I TGATCA 1 cut(s) 271
Kzo9I GATC 3 cut(s) 39, 142, 271
LpnPI CCDG 3 cut(s) 80, 107, 168
LweI GCATC 3 cut(s) 52, 91, 190
MaeI CTAG 1 cut(s) 129
MaeII ACGT 1 cut(s) 88
MaeIII GTNAC 2 cut(s) 89, 131
MalI GATC 3 cut(s) 41, 144, 273
MboI GATC 3 cut(s) 39, 142, 271
MboII GAAGA 1 cut(s) 228
MluCI AATT 3 cut(s) 76, 221, 275
MnlI CCTC 1 cut(s) 169
MseI TTAA 1 cut(s) 289
MslI CAYNNNNRTG 1 cut(s) 129
MspR9I CCNGG 1 cut(s) 95
MvaI CCWGG 1 cut(s) 95
NdeII GATC 3 cut(s) 39, 142, 271
NlaIII CATG 3 cut(s) 128, 188, 233
NmuCI GTSAC 2 cut(s) 89, 131
NspI RCATGY 1 cut(s) 128
PaeI GCATGC 1 cut(s) 128
PfeI GAWTC 3 cut(s) 113, 233, 248
PpuMI RGGWCCY 1 cut(s) 6
Psp5II RGGWCCY 1 cut(s) 6
Psp6I CCWGG 1 cut(s) 93
PspGI CCWGG 1 cut(s) 93
PspPI GGNCC 1 cut(s) 6
PspPPI RGGWCCY 1 cut(s) 6
RsaI GTAC 2 cut(s) 18, 74
RsaNI GTAC 2 cut(s) 17, 73
RseI CAYNNNNRTG 1 cut(s) 129
SaqAI TTAA 1 cut(s) 289
Sau3AI GATC 3 cut(s) 39, 142, 271
Sau96I GGNCC 1 cut(s) 6
ScrFI CCNGG 1 cut(s) 95
SetI ASST 5 cut(s) 11, 61, 74, 91, 96
SfaNI GCATC 3 cut(s) 52, 91, 190
SinI GGWCC 1 cut(s) 6
SmiMI CAYNNNNRTG 1 cut(s) 129
SphI GCATGC 1 cut(s) 128
Sse9I AATT 3 cut(s) 76, 221, 275
SspMI CTAG 1 cut(s) 129
StyD4I CCNGG 1 cut(s) 93
TaaI ACNGT 1 cut(s) 257
TaiI ACGT 1 cut(s) 91
TaqI TCGA 1 cut(s) 267
TasI AATT 3 cut(s) 76, 221, 275
TatI WGTACW 1 cut(s) 16
TfiI GAWTC 3 cut(s) 113, 233, 248
Tru1I TTAA 1 cut(s) 289
Tru9I TTAA 1 cut(s) 289
TseFI GTSAC 2 cut(s) 89, 131
Tsp45I GTSAC 2 cut(s) 89, 131
VpaK11BI GGWCC 1 cut(s) 6
XapI RAATTY 1 cut(s) 221
XceI RCATGY 1 cut(s) 128
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.