MD17G1062000.v1.1

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Forward (+)
5042951 .. 5043724
774 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1062000.v1.1.491

Sequence Viewer

Length: 165 bp
ATGTTTCATTGTGACTTGCTAAATATGCCTGCTGTAGAGCAACTGGAGAAGGATGCTAAGCATGCATTGGCATATCAGCTTATGAAGATCTTTCTGACTGAGAGGCTCGATGCTTACTTGGAGTTTCAAGCTGCAAATTCTGATTTACTGAAAAGCTACGATTAA

Protein Analysis

55

Amino Acids

6.31

Weight (kDa)

4.85

Isoelectric Point (pI)

33.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 136
AgsI TTSAA 1 cut(s) 128
AluBI AGCT 3 cut(s) 79, 131, 156
AluI AGCT 3 cut(s) 79, 131, 156
ApeKI GCWGC 1 cut(s) 131
ApoI RAATTY 1 cut(s) 136
BbvI GCAGC 1 cut(s) 118
BfmI CTRYAG 1 cut(s) 33
BglII AGATCT 1 cut(s) 87
BisI GCNGC 1 cut(s) 132
BlpI GCTNAGC 1 cut(s) 57
BlsI GCNGC 1 cut(s) 133
BmsI GCATC 2 cut(s) 43, 100
BpmI CTGGAG 1 cut(s) 65
Bpu1102I GCTNAGC 1 cut(s) 57
Bse1I ACTGG 1 cut(s) 48
BseGI GGATG 1 cut(s) 58
BseMII CTCAG 1 cut(s) 90
BseNI ACTGG 1 cut(s) 48
BseXI GCAGC 1 cut(s) 118
Bsp143I GATC 1 cut(s) 87
Bsp1720I GCTNAGC 1 cut(s) 57
BspCNI CTCAG 1 cut(s) 91
BsrI ACTGG 1 cut(s) 48
BssMI GATC 1 cut(s) 87
BstC8I GCNNGC 2 cut(s) 30, 63
BstDEI CTNAG 2 cut(s) 57, 99
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 1 cut(s) 90
BstMBI GATC 1 cut(s) 87
BstMWI GCNNNNNNNGC 2 cut(s) 25, 62
BstNSI RCATGY 1 cut(s) 65
BstSFI CTRYAG 1 cut(s) 33
BstV1I GCAGC 1 cut(s) 118
BstX2I RGATCY 1 cut(s) 87
BstYI RGATCY 1 cut(s) 87
BtsCI GGATG 1 cut(s) 58
Cac8I GCNNGC 2 cut(s) 30, 63
CviAII CATG 1 cut(s) 62
CviJI RGCY 4 cut(s) 79, 106, 131, 156
CviKI_1 RGCY 4 cut(s) 79, 106, 131, 156
DdeI CTNAG 2 cut(s) 57, 99
DpnI GATC 1 cut(s) 89
DpnII GATC 1 cut(s) 87
EcoT22I ATGCAT 1 cut(s) 67
FaeI CATG 1 cut(s) 65
FaiI YATR 4 cut(s) 26, 63, 73, 83
FatI CATG 1 cut(s) 61
Fnu4HI GCNGC 1 cut(s) 132
FokI GGATG 1 cut(s) 65
Fsp4HI GCNGC 1 cut(s) 132
FspEI CC 6 cut(s) 29, 35, 42, 53, 88, 104
GluI GCNGC 1 cut(s) 132
GsuI CTGGAG 1 cut(s) 65
Hin1II CATG 1 cut(s) 65
Hpy188I TCNGA 2 cut(s) 96, 142
HpyAV CCTTC 1 cut(s) 43
HpyCH4V TGCA 2 cut(s) 65, 134
HpyF10VI GCNNNNNNNGC 2 cut(s) 25, 62
HpyF3I CTNAG 2 cut(s) 57, 99
Hsp92II CATG 1 cut(s) 65
Kzo9I GATC 1 cut(s) 87
LpnPI CCDG 2 cut(s) 29, 42
Lsp1109I GCAGC 1 cut(s) 118
LweI GCATC 2 cut(s) 43, 100
MaeIII GTNAC 1 cut(s) 11
MalI GATC 1 cut(s) 89
MboI GATC 1 cut(s) 87
MboII GAAGA 1 cut(s) 97
MflI RGATCY 1 cut(s) 87
MluCI AATT 1 cut(s) 136
MnlI CCTC 1 cut(s) 96
Mph1103I ATGCAT 1 cut(s) 67
MseI TTAA 1 cut(s) 163
MwoI GCNNNNNNNGC 2 cut(s) 25, 62
NdeII GATC 1 cut(s) 87
NlaIII CATG 1 cut(s) 65
NmuCI GTSAC 1 cut(s) 11
NsiI ATGCAT 1 cut(s) 67
NspI RCATGY 1 cut(s) 65
PaeI GCATGC 1 cut(s) 65
PkrI GCNGC 1 cut(s) 133
PsuI RGATCY 1 cut(s) 87
SaqAI TTAA 1 cut(s) 163
SatI GCNGC 1 cut(s) 132
Sau3AI GATC 1 cut(s) 87
SetI ASST 3 cut(s) 81, 133, 158
SfaNI GCATC 2 cut(s) 43, 100
SfcI CTRYAG 1 cut(s) 33
SgeI CNNG 7 cut(s) 28, 41, 56, 74, 119, 130, 140
SphI GCATGC 1 cut(s) 65
Sse9I AATT 1 cut(s) 136
TaqI TCGA 1 cut(s) 108
TasI AATT 1 cut(s) 136
Tru1I TTAA 1 cut(s) 163
Tru9I TTAA 1 cut(s) 163
TseFI GTSAC 1 cut(s) 11
TseI GCWGC 1 cut(s) 131
Tsp45I GTSAC 1 cut(s) 11
TspDTI ATGAA 1 cut(s) 98
XapI RAATTY 1 cut(s) 136
XceI RCATGY 1 cut(s) 65
Zsp2I ATGCAT 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.