Rmu_sc0004031.1_g000019

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004031.1
Physical Location & Seq
Forward (+)
83066 .. 83375
310 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004031.1_g000019.1.cds

Sequence Viewer

Length: 231 bp
atgagcagctcagatgaggctgttcgcacaattgtggaatttgtgaagacaccggacatgtttcagtgtgatttgttagatatgcctgctgtagcacagttggagaaggatgctaaacatgcatcggcatatcagcttttgaaggtatttttgacccagaggctggttgtgtgcttggagtttcaggcagcaaatattacacttgcttcaaagctatggtctggtccatga

Protein Analysis

76

Amino Acids

8.46

Weight (kDa)

5.12

Isoelectric Point (pI)

35.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 163
AcsI RAATTY 1 cut(s) 38
AfiI CCNNNNNNNGG 1 cut(s) 163
AflIII ACRYGT 1 cut(s) 57
AgsI TTSAA 2 cut(s) 142, 210
AleI CACNNNNGTG 1 cut(s) 32
AluBI AGCT 3 cut(s) 9, 136, 214
AluI AGCT 3 cut(s) 9, 136, 214
AlwNI CAGNNNCTG 1 cut(s) 163
ApeKI GCWGC 2 cut(s) 6, 188
ApoI RAATTY 1 cut(s) 38
ArsI GACNNNNNNTTYG 1 cut(s) 203
AspS9I GGNCC 1 cut(s) 224
AvaII GGWCC 1 cut(s) 224
BbsI GAAGAC 1 cut(s) 53
BbvI GCAGC 2 cut(s) 18, 200
BfmI CTRYAG 1 cut(s) 90
BisI GCNGC 2 cut(s) 7, 189
BlsI GCNGC 2 cut(s) 8, 190
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 1 cut(s) 224
BmsI GCATC 2 cut(s) 100, 131
BpiI GAAGAC 1 cut(s) 53
BsaWI WCCGGW 1 cut(s) 52
Bsc4I CCNNNNNNNGG 1 cut(s) 163
BseGI GGATG 1 cut(s) 115
BseLI CCNNNNNNNGG 1 cut(s) 163
BseMII CTCAG 1 cut(s) 24
BseXI GCAGC 2 cut(s) 18, 200
BsiSI CCGG 1 cut(s) 53
BslI CCNNNNNNNGG 1 cut(s) 163
BspCNI CTCAG 1 cut(s) 23
Bst4CI ACNGT 1 cut(s) 99
BstC8I GCNNGC 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 10
BstF5I GGATG 1 cut(s) 115
BstMWI GCNNNNNNNGC 1 cut(s) 119
BstNSI RCATGY 2 cut(s) 61, 122
BstSFI CTRYAG 1 cut(s) 90
BstV1I GCAGC 2 cut(s) 18, 200
BstV2I GAAGAC 1 cut(s) 53
BtsCI GGATG 1 cut(s) 115
BtsIMutI CAGTG 1 cut(s) 71
Cac8I GCNNGC 1 cut(s) 87
CaiI CAGNNNCTG 1 cut(s) 163
Cfr13I GGNCC 1 cut(s) 224
CviAII CATG 3 cut(s) 58, 119, 228
CviJI RGCY 5 cut(s) 9, 20, 136, 163, 214
CviKI_1 RGCY 5 cut(s) 9, 20, 136, 163, 214
DdeI CTNAG 1 cut(s) 10
Eco47I GGWCC 1 cut(s) 224
EcoT22I ATGCAT 1 cut(s) 124
FaeI CATG 3 cut(s) 61, 122, 231
FaiI YATR 6 cut(s) 59, 83, 120, 130, 217, 229
FatI CATG 3 cut(s) 57, 118, 227
Fnu4HI GCNGC 2 cut(s) 7, 189
FokI GGATG 1 cut(s) 122
Fsp4HI GCNGC 2 cut(s) 7, 189
GluI GCNGC 2 cut(s) 7, 189
HapII CCGG 1 cut(s) 53
Hin1II CATG 3 cut(s) 61, 122, 231
HpaII CCGG 1 cut(s) 53
Hpy188I TCNGA 1 cut(s) 13
HpyAV CCTTC 2 cut(s) 100, 136
HpyCH4III ACNGT 1 cut(s) 99
HpyCH4V TGCA 1 cut(s) 122
HpyF10VI GCNNNNNNNGC 1 cut(s) 119
HpyF3I CTNAG 1 cut(s) 10
Hsp92II CATG 3 cut(s) 61, 122, 231
LpnPI CCDG 6 cut(s) 66, 99, 149, 170, 170, 207
Lsp1109I GCAGC 2 cut(s) 18, 200
LweI GCATC 2 cut(s) 100, 131
MboII GAAGA 1 cut(s) 58
MfeI CAATTG 1 cut(s) 30
MluCI AATT 2 cut(s) 30, 38
MmeI TCCRAC 1 cut(s) 81
MnlI CCTC 2 cut(s) 10, 153
Mph1103I ATGCAT 1 cut(s) 124
MslI CAYNNNNRTG 1 cut(s) 32
MspI CCGG 1 cut(s) 53
MunI CAATTG 1 cut(s) 30
MwoI GCNNNNNNNGC 1 cut(s) 119
NlaIII CATG 3 cut(s) 61, 122, 231
NsiI ATGCAT 1 cut(s) 124
NspI RCATGY 2 cut(s) 61, 122
OliI CACNNNNGTG 1 cut(s) 32
PciI ACATGT 1 cut(s) 57
PflMI CCANNNNNTGG 1 cut(s) 163
PkrI GCNGC 2 cut(s) 8, 190
PscI ACATGT 1 cut(s) 57
PspPI GGNCC 1 cut(s) 224
PstNI CAGNNNCTG 1 cut(s) 163
RseI CAYNNNNRTG 1 cut(s) 32
SatI GCNGC 2 cut(s) 7, 189
Sau96I GGNCC 1 cut(s) 224
SetI ASST 4 cut(s) 11, 138, 147, 216
SfaNI GCATC 2 cut(s) 100, 131
SfcI CTRYAG 1 cut(s) 90
SgeI CNNG 9 cut(s) 65, 70, 98, 131, 169, 176, 187, 197, 215
SinI GGWCC 1 cut(s) 224
SmiMI CAYNNNNRTG 1 cut(s) 32
Sse9I AATT 2 cut(s) 30, 38
SspI AATATT 1 cut(s) 196
TaaI ACNGT 1 cut(s) 99
TasI AATT 2 cut(s) 30, 38
TscAI CASTG 1 cut(s) 71
TseI GCWGC 2 cut(s) 6, 188
TspRI CASTG 1 cut(s) 71
Van91I CCANNNNNTGG 1 cut(s) 163
VpaK11BI GGWCC 1 cut(s) 224
XapI RAATTY 1 cut(s) 38
XceI RCATGY 2 cut(s) 61, 122
Zsp2I ATGCAT 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.