RchiOBHm_Chr2g0157101

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
73552530 .. 73556153
3624 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52586

Sequence Viewer

Length: 213 bp
ATGCCTGCTGTAGCGCAGTTGGAGAAGGATGCTAAACATGCATTGGCATATCAACTTTTGAAGGTATTTTTGACCCAGAGGCTGGATGCTTACTTGGAGTTTCAGGCAGCAAATTCTACTCTGCTACAAAGCTGTGGTCTGGTCCATGAAGATTGTATTACTAAGATGAGGTTGATTTCATTGGTGGATCTGGGCTCTGATGAATCTGGATGA

Protein Analysis

70

Amino Acids

7.72

Weight (kDa)

5.07

Isoelectric Point (pI)

37.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 82
AclWI GGATC 1 cut(s) 195
AcsI RAATTY 1 cut(s) 112
AfiI CCNNNNNNNGG 1 cut(s) 82
AgsI TTSAA 1 cut(s) 61
AluBI AGCT 1 cut(s) 132
AluI AGCT 1 cut(s) 132
AlwI GGATC 1 cut(s) 195
AlwNI CAGNNNCTG 1 cut(s) 82
ApeKI GCWGC 1 cut(s) 107
ApoI RAATTY 1 cut(s) 112
ArsI GACNNNNNNTTYG 2 cut(s) 121, 153
AspLEI GCGC 1 cut(s) 16
AspS9I GGNCC 1 cut(s) 142
AvaII GGWCC 1 cut(s) 142
BanII GRGCYC 1 cut(s) 197
BbvI GCAGC 1 cut(s) 119
BfmI CTRYAG 1 cut(s) 9
BisI GCNGC 1 cut(s) 108
BlsI GCNGC 1 cut(s) 109
Bme18I GGWCC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 142
BmsI GCATC 2 cut(s) 19, 76
Bsc4I CCNNNNNNNGG 1 cut(s) 82
BseGI GGATG 2 cut(s) 34, 91
BseLI CCNNNNNNNGG 1 cut(s) 82
BseXI GCAGC 1 cut(s) 119
BslI CCNNNNNNNGG 1 cut(s) 82
Bsp1286I GDGCHC 1 cut(s) 197
Bsp143I GATC 1 cut(s) 187
BspPI GGATC 1 cut(s) 195
BssMI GATC 1 cut(s) 187
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 162
BstF5I GGATG 2 cut(s) 34, 91
BstHHI GCGC 1 cut(s) 16
BstKTI GATC 1 cut(s) 190
BstMBI GATC 1 cut(s) 187
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstNSI RCATGY 1 cut(s) 41
BstSFI CTRYAG 1 cut(s) 9
BstV1I GCAGC 1 cut(s) 119
BstX2I RGATCY 1 cut(s) 187
BstYI RGATCY 1 cut(s) 187
BtsCI GGATG 2 cut(s) 34, 91
Cac8I GCNNGC 1 cut(s) 6
CaiI CAGNNNCTG 1 cut(s) 82
CfoI GCGC 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 142
CviAII CATG 2 cut(s) 38, 146
CviJI RGCY 3 cut(s) 82, 132, 195
CviKI_1 RGCY 3 cut(s) 82, 132, 195
DdeI CTNAG 1 cut(s) 162
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
Eco24I GRGCYC 1 cut(s) 197
Eco47I GGWCC 1 cut(s) 142
EcoT22I ATGCAT 1 cut(s) 43
EcoT38I GRGCYC 1 cut(s) 197
FaeI CATG 2 cut(s) 41, 149
FaiI YATR 3 cut(s) 39, 49, 147
FatI CATG 2 cut(s) 37, 145
Fnu4HI GCNGC 1 cut(s) 108
FokI GGATG 2 cut(s) 41, 98
FriOI GRGCYC 1 cut(s) 197
Fsp4HI GCNGC 1 cut(s) 108
GlaI GCGC 1 cut(s) 15
GluI GCNGC 1 cut(s) 108
HhaI GCGC 1 cut(s) 16
Hin1II CATG 2 cut(s) 41, 149
Hin6I GCGC 1 cut(s) 14
HinP1I GCGC 1 cut(s) 14
HinfI GANTC 1 cut(s) 203
Hpy188I TCNGA 1 cut(s) 199
Hpy188III TCNNGA 1 cut(s) 207
HpyAV CCTTC 2 cut(s) 19, 55
HpyCH4V TGCA 1 cut(s) 41
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpyF3I CTNAG 1 cut(s) 162
Hsp92II CATG 2 cut(s) 41, 149
HspAI GCGC 1 cut(s) 14
Kzo9I GATC 1 cut(s) 187
LpnPI CCDG 7 cut(s) 18, 68, 89, 89, 125, 176, 192
Lsp1109I GCAGC 1 cut(s) 119
LweI GCATC 2 cut(s) 19, 76
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MboII GAAGA 1 cut(s) 161
MflI RGATCY 1 cut(s) 187
MhlI GDGCHC 1 cut(s) 197
MluCI AATT 1 cut(s) 112
MnlI CCTC 2 cut(s) 72, 162
Mph1103I ATGCAT 1 cut(s) 43
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeII GATC 1 cut(s) 187
NlaIII CATG 2 cut(s) 41, 149
NsiI ATGCAT 1 cut(s) 43
NspI RCATGY 1 cut(s) 41
PfeI GAWTC 1 cut(s) 203
PflMI CCANNNNNTGG 1 cut(s) 82
PkrI GCNGC 1 cut(s) 109
PspPI GGNCC 1 cut(s) 142
PstNI CAGNNNCTG 1 cut(s) 82
PsuI RGATCY 1 cut(s) 187
SatI GCNGC 1 cut(s) 108
Sau3AI GATC 1 cut(s) 187
Sau96I GGNCC 1 cut(s) 142
SduI GDGCHC 1 cut(s) 197
SetI ASST 3 cut(s) 66, 134, 173
SfaNI GCATC 2 cut(s) 19, 76
SfcI CTRYAG 1 cut(s) 9
SgeI CNNG 9 cut(s) 17, 50, 88, 95, 106, 116, 152, 158, 203
SinI GGWCC 1 cut(s) 142
Sse9I AATT 1 cut(s) 112
TasI AATT 1 cut(s) 112
TfiI GAWTC 1 cut(s) 203
TseI GCWGC 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 162, 168
Van91I CCANNNNNTGG 1 cut(s) 82
VpaK11BI GGWCC 1 cut(s) 142
XapI RAATTY 1 cut(s) 112
XceI RCATGY 1 cut(s) 41
Zsp2I ATGCAT 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.