Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp01

Orthogroup ID

OG0003939

Physical Location & Seq

Genomic Coordinates Reverse (-)

41133921 .. 41135456

Gene Structure 1536 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.1G495800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 615 bp

ATGTTGGGTTTTTGTGACAGTATTCGTTTGAGGCATGCACCCTTGCTTGTTAATGTATCTCTTGCAGAAAGTACTAGGTCTATAATTGCACCTTTTCTTTCGGTTAAAAGTTGTATTCCTCAGCTGGTGACTCTCAACTTGCACATGAATCTGAATTCGAGAGGAGGGGTGTGGCTCCCAGAATTTCCAGAATTTACTTGTCTCAAGGACTTGTCATTGAGTGTTATCGCAACTGATCGGCTAAGCCTCCTTGCTTTGACTAAATTGATAGAGCGGTCTCCTTTCTTGCATGGATTTACATTGAAGTTAAGATGGGTACGCGACTCGTGTCAGAGGAATATGCAGAAGGTTAATAAATGTCCTCATCAGTGCCTTAAGGTGGTGAAATTTTCTGGGTTCGTTGGGTCTATTATCGACACTGAGCTTGCCATGTACTTCACTGAGAATGCCGTTGCACTTGAAACGTTTATCATCGATCTCAAAAAGGTTGTCATTGAAGAATCCACTCTATTGTCTGAATTTGTTACAACCCAGAAAAAAATGAGGGCAACAAGAAAGCGGGCCTTGCAGATTGGAGAAAAACTACCGCCAGGAGCTGAGTTAATTGTTGTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBD

Protein Analysis

205

Amino Acids

22.96

Weight (kDa)

9.36

Isoelectric Point (pI)

50.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003939)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g27810
malus_domestica	MD02G1120400.v1.1 MD02G1120500.v1.1
prunus_persica	Prupe.1G495700_v2.0.a1 Prupe.1G495800_v2.0.a1 Prupe.1G495900_v2.0.a1 Prupe.1G496000_v2.0.a1 Prupe.1G496200_v2.0.a1 Prupe.1G496300_v2.0.a1 Prupe.1G496400_v2.0.a1 Prupe.1G496400_v2.0.a1 Prupe.1G496400_v2.0.a1 Prupe.1G496600_v2.0.a1 Prupe.1G496800_v2.0.a1 Prupe.1G496800_v2.0.a1 Prupe.3G136800_v2.0.a1 Prupe.3G136800_v2.0.a1 Prupe.3G136800_v2.0.a1 Prupe.3G136800_v2.0.a1 Prupe.3G257200_v2.0.a1
pyrus_communis	pycom02g09400
rosa_chinensis	RchiOBHm_Chr1g0349301 RchiOBHm_Chr6g0295841
rosa_laevigata	RLG00000028560
rosa_multiflora	Rmu_sc0000827.1_g000005 Rmu_sc0002914.1_g000007 Rmu_sc0025718.1_g000002
rosa_roxburghii	Rroxscaffold_4G00305670 Rroxscaffold_6G00388420
rosa_rugosa	Rorug01G0202400
rosa_samantha	Rh1AG220000 Rh1BG186100 Rh1CG205100
rosa_wichuraiana	Rw1G018680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	274
AccII	CGCG	1 cut(s)	321
AciI	CCGC	3 cut(s)	274, 559, 587
AclI	AACGTT	1 cut(s)	464
AcsI	RAATTY	5 cut(s)	154, 182, 191, 386, 518
AfaI	GTAC	3 cut(s)	73, 318, 434
AfiI	CCNNNNNNNGG	1 cut(s)	379
AflII	CTTAAG	1 cut(s)	374
AgsI	TTSAA	3 cut(s)	304, 461, 497
AjnI	CCWGG	1 cut(s)	589
AluBI	AGCT	3 cut(s)	124, 424, 596
AluI	AGCT	3 cut(s)	124, 424, 596
Alw26I	GTCTC	2 cut(s)	206, 282
AlwNI	CAGNNNCTG	1 cut(s)	596
AoxI	GGCC	1 cut(s)	561
ApoI	RAATTY	5 cut(s)	154, 182, 191, 386, 518
ArsI	GACNNNNNNTTYG	2 cut(s)	474, 506
AspS9I	GGNCC	1 cut(s)	561
AsuHPI	GGTGA	2 cut(s)	139, 394
BauI	CACGAG	1 cut(s)	325
BbvCI	CCTCAGC	1 cut(s)	120
BccI	CCATC	1 cut(s)	306
BceAI	ACGGC	1 cut(s)	434
BciT130I	CCWGG	1 cut(s)	591
BcoDI	GTCTC	2 cut(s)	206, 282
BfaI	CTAG	1 cut(s)	75
BfrI	CTTAAG	1 cut(s)	374
BlpI	GCTNAGC	1 cut(s)	242
BmcAI	AGTACT	1 cut(s)	73
Bme1390I	CCNGG	1 cut(s)	591
BmgT120I	GGNCC	1 cut(s)	561
BmiI	GGNNCC	1 cut(s)	176
BmrFI	CCNGG	1 cut(s)	591
BoxI	GACNNNNGTC	1 cut(s)	327
Bpu10I	CCTNAGC	1 cut(s)	120
Bpu1102I	GCTNAGC	1 cut(s)	242
BpuEI	CTTGAG	1 cut(s)	188
Bsa29I	ATCGAT	1 cut(s)	474
BsaI	GGTCTC	1 cut(s)	282
Bsc4I	CCNNNNNNNGG	1 cut(s)	379
BseBI	CCWGG	1 cut(s)	591
BseCI	ATCGAT	1 cut(s)	474
BseLI	CCNNNNNNNGG	1 cut(s)	379
BseMII	CTCAG	4 cut(s)	134, 411, 432, 588
BseRI	GAGGAG	1 cut(s)	177
Bsh1236I	CGCG	1 cut(s)	321
BshFI	GGCC	1 cut(s)	563
BshVI	ATCGAT	1 cut(s)	474
BslI	CCNNNNNNNGG	1 cut(s)	379
BsmAI	GTCTC	2 cut(s)	206, 282
BsmI	GAATGC	1 cut(s)	451
BsnI	GGCC	1 cut(s)	563
Bso31I	GGTCTC	1 cut(s)	282
Bsp143I	GATC	2 cut(s)	235, 475
Bsp1720I	GCTNAGC	1 cut(s)	242
BspACI	CCGC	3 cut(s)	274, 559, 587
BspANI	GGCC	1 cut(s)	563
BspCNI	CTCAG	4 cut(s)	133, 412, 433, 589
BspDI	ATCGAT	1 cut(s)	474
BspFNI	CGCG	1 cut(s)	321
BspLI	GGNNCC	1 cut(s)	176
BspTI	CTTAAG	1 cut(s)	374
BspTNI	GGTCTC	1 cut(s)	282
BsrBI	CCGCTC	1 cut(s)	274
BssMI	GATC	2 cut(s)	235, 475
BssSI	CACGAG	1 cut(s)	325
Bst2BI	CACGAG	1 cut(s)	325
Bst2UI	CCWGG	1 cut(s)	591
Bst4CI	ACNGT	1 cut(s)	20
BstAFI	CTTAAG	1 cut(s)	374
BstC8I	GCNNGC	3 cut(s)	36, 426, 561
BstDEI	CTNAG	5 cut(s)	120, 242, 420, 441, 597
BstFNI	CGCG	1 cut(s)	321
BstKTI	GATC	2 cut(s)	238, 478
BstMAI	GTCTC	2 cut(s)	206, 282
BstMBI	GATC	2 cut(s)	235, 475
BstMWI	GCNNNNNNNGC	1 cut(s)	565
BstNI	CCWGG	1 cut(s)	591
BstNSI	RCATGY	1 cut(s)	38
BstPAI	GACNNNNGTC	1 cut(s)	327
BstSCI	CCNGG	1 cut(s)	589
BstUI	CGCG	1 cut(s)	321
Bsu15I	ATCGAT	1 cut(s)	474
BsuRI	GGCC	1 cut(s)	563
BsuTUI	ATCGAT	1 cut(s)	474
BtsIMutI	CAGTG	3 cut(s)	374, 417, 438
Cac8I	GCNNGC	3 cut(s)	36, 426, 561
CaiI	CAGNNNCTG	1 cut(s)	596
Cfr13I	GGNCC	1 cut(s)	561
ClaI	ATCGAT	1 cut(s)	474
Csp6I	GTAC	3 cut(s)	72, 317, 433
CviAII	CATG	4 cut(s)	35, 145, 290, 430
CviJI	RGCY	7 cut(s)	124, 175, 241, 246, 424, 563, 596
CviKI_1	RGCY	7 cut(s)	124, 175, 241, 246, 424, 563, 596
CviQI	GTAC	3 cut(s)	72, 317, 433
DdeI	CTNAG	5 cut(s)	120, 242, 420, 441, 597
DpnI	GATC	2 cut(s)	237, 477
DpnII	GATC	2 cut(s)	235, 475
Eco31I	GGTCTC	1 cut(s)	282
EcoRI	GAATTC	1 cut(s)	154
EcoRII	CCWGG	1 cut(s)	589
FaeI	CATG	4 cut(s)	38, 148, 293, 433
FaiI	YATR	6 cut(s)	36, 83, 146, 291, 341, 431
FalI	AAGNNNNNCTT	2 cut(s)	548, 580
FatI	CATG	4 cut(s)	34, 144, 289, 429
FauI	CCCGC	1 cut(s)	552
FspBI	CTAG	1 cut(s)	75
HaeIII	GGCC	1 cut(s)	563
Hin1II	CATG	4 cut(s)	38, 148, 293, 433
HinfI	GANTC	4 cut(s)	130, 148, 323, 500
HphI	GGTGA	2 cut(s)	139, 394
Hpy188I	TCNGA	3 cut(s)	153, 333, 517
Hpy188III	TCNNGA	2 cut(s)	159, 188
HpyAV	CCTTC	1 cut(s)	340
HpyCH4III	ACNGT	1 cut(s)	20
HpyCH4IV	ACGT	1 cut(s)	464
HpyCH4V	TGCA	8 cut(s)	38, 65, 89, 142, 289, 343, 455, 568
HpyF10VI	GCNNNNNNNGC	1 cut(s)	565
HpyF3I	CTNAG	5 cut(s)	120, 242, 420, 441, 597
HpySE526I	ACGT	1 cut(s)	464
Hsp92II	CATG	4 cut(s)	38, 148, 293, 433
Kzo9I	GATC	2 cut(s)	235, 475
LmnI	GCTCC	2 cut(s)	180, 593
LpnPI	CCDG	7 cut(s)	110, 192, 201, 378, 545, 576, 603
MaeI	CTAG	1 cut(s)	75
MaeII	ACGT	1 cut(s)	464
MaeIII	GTNAC	3 cut(s)	14, 127, 523
MalI	GATC	2 cut(s)	237, 477
MbiI	CCGCTC	1 cut(s)	274
MboI	GATC	2 cut(s)	235, 475
MboII	GAAGA	1 cut(s)	509
MluCI	AATT	8 cut(s)	84, 154, 182, 191, 263, 386, 518, 603
MlyI	GAGTC	2 cut(s)	124, 317
MnlI	CCTC	8 cut(s)	24, 129, 155, 158, 257, 327, 372, 537
MseI	TTAA	6 cut(s)	51, 105, 308, 351, 375, 602
MspA1I	CMGCKG	1 cut(s)	124
MspCI	CTTAAG	1 cut(s)	374
MspR9I	CCNGG	1 cut(s)	591
Mva1269I	GAATGC	1 cut(s)	451
MvaI	CCWGG	1 cut(s)	591
MvnI	CGCG	1 cut(s)	321
MwoI	GCNNNNNNNGC	1 cut(s)	565
NdeII	GATC	2 cut(s)	235, 475
NlaIII	CATG	4 cut(s)	38, 148, 293, 433
NlaIV	GGNNCC	1 cut(s)	176
NmuCI	GTSAC	2 cut(s)	14, 127
NspI	RCATGY	1 cut(s)	38
PaeI	GCATGC	1 cut(s)	38
PctI	GAATGC	1 cut(s)	451
PfeI	GAWTC	2 cut(s)	148, 500
PleI	GAGTC	2 cut(s)	124, 317
PpsI	GAGTC	2 cut(s)	124, 317
PshAI	GACNNNNGTC	1 cut(s)	327
Psp1406I	AACGTT	1 cut(s)	464
Psp6I	CCWGG	1 cut(s)	589
PspGI	CCWGG	1 cut(s)	589
PspN4I	GGNNCC	1 cut(s)	176
PspPI	GGNCC	1 cut(s)	561
PstNI	CAGNNNCTG	1 cut(s)	596
PvuII	CAGCTG	1 cut(s)	124
RsaI	GTAC	3 cut(s)	73, 318, 434
RsaNI	GTAC	3 cut(s)	72, 317, 433
SaqAI	TTAA	6 cut(s)	51, 105, 308, 351, 375, 602
Sau3AI	GATC	2 cut(s)	235, 475
Sau96I	GGNCC	1 cut(s)	561
ScaI	AGTACT	1 cut(s)	73
SchI	GAGTC	2 cut(s)	124, 317
ScrFI	CCNGG	1 cut(s)	591
SetI	ASST	9 cut(s)	80, 94, 126, 351, 381, 426, 467, 489, 598
SmlI	CTYRAG	2 cut(s)	203, 374
SmoI	CTYRAG	2 cut(s)	203, 374
SphI	GCATGC	1 cut(s)	38
Sse9I	AATT	8 cut(s)	84, 154, 182, 191, 263, 386, 518, 603
SsiI	CCGC	3 cut(s)	274, 559, 587
SspMI	CTAG	1 cut(s)	75
StyD4I	CCNGG	1 cut(s)	589
TaaI	ACNGT	1 cut(s)	20
TaiI	ACGT	1 cut(s)	467
TaqI	TCGA	3 cut(s)	158, 414, 474
TasI	AATT	8 cut(s)	84, 154, 182, 191, 263, 386, 518, 603
TatI	WGTACW	2 cut(s)	71, 432
TfiI	GAWTC	2 cut(s)	148, 500
Tru1I	TTAA	6 cut(s)	51, 105, 308, 351, 375, 602
Tru9I	TTAA	6 cut(s)	51, 105, 308, 351, 375, 602
TscAI	CASTG	3 cut(s)	374, 424, 445
TseFI	GTSAC	2 cut(s)	14, 127
Tsp45I	GTSAC	2 cut(s)	14, 127
TspDTI	ATGAA	1 cut(s)	161
TspRI	CASTG	3 cut(s)	374, 424, 445
Vha464I	CTTAAG	1 cut(s)	374
XapI	RAATTY	5 cut(s)	154, 182, 191, 386, 518
XceI	RCATGY	1 cut(s)	38
XspI	CTAG	1 cut(s)	75
ZrmI	AGTACT	1 cut(s)	73

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.