Prupe.4G033400_v2.0.a1

Calcium-binding protein PBP1-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
1557801 .. 1558540
740 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G033400.1

Sequence Viewer

Length: 342 bp
ATGGCTTTAGGTGGTGGAGTTGTGTTTGAAGACTTCTTTCCAGTCATGGTGGAGAGGTTGGGAGCAGAAGGGTTCATGAAGGAGCTGTGCAACGGGTTTCGGTTGTTAATGGACGGAGCGAAAGGCATGATCACATTCGAGAGCTTGAAGAGAAACTCTGCATTGCTGGGGTTGCAGGATATGAGTGATGATGACTTGAAGTGCATGCTGAGAGAAGGTGATTTGGATGGTGATGGGAGTTTGAATGAGATGGAGTTTTGTACTCTCATGTTTAGGTTGAGCCCTGCTTTGATGCAAACGTCTAAAGACTTGATGGAGGAAGCTCTTGCTTTTGAGTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.58

Weight (kDa)

4.23

Isoelectric Point (pI)

43.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 262
AgsI TTSAA 4 cut(s) 29, 148, 199, 244
AluBI AGCT 3 cut(s) 85, 144, 323
AluI AGCT 3 cut(s) 85, 144, 323
AsuHPI GGTGA 2 cut(s) 230, 242
BanII GRGCYC 1 cut(s) 284
BbsI GAAGAC 1 cut(s) 36
BccI CCATC 4 cut(s) 221, 227, 244, 307
BclI TGATCA 1 cut(s) 129
BfaI CTAG 1 cut(s) 340
BmsI GCATC 1 cut(s) 282
BpiI GAAGAC 1 cut(s) 36
Bse1I ACTGG 1 cut(s) 41
Bse3DI GCAATG 1 cut(s) 161
BseGI GGATG 1 cut(s) 232
BseMI GCAATG 1 cut(s) 161
BseMII CTCAG 1 cut(s) 200
BseNI ACTGG 1 cut(s) 41
BseYI CCCAGC 1 cut(s) 166
Bsp1286I GDGCHC 1 cut(s) 284
Bsp143I GATC 1 cut(s) 129
BspCNI CTCAG 1 cut(s) 201
BspHI TCATGA 1 cut(s) 75
BsrDI GCAATG 1 cut(s) 161
BsrI ACTGG 1 cut(s) 41
BssMI GATC 1 cut(s) 129
Bst6I CTCTTC 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 206
BstDEI CTNAG 1 cut(s) 209
BstF5I GGATG 1 cut(s) 232
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
BstMWI GCNNNNNNNGC 1 cut(s) 172
BstNSI RCATGY 1 cut(s) 208
BstV2I GAAGAC 1 cut(s) 36
BtsCI GGATG 1 cut(s) 232
Cac8I GCNNGC 1 cut(s) 206
CciI TCATGA 1 cut(s) 75
Csp6I GTAC 1 cut(s) 261
CviAII CATG 5 cut(s) 46, 76, 127, 205, 268
CviJI RGCY 5 cut(s) 5, 85, 144, 282, 323
CviKI_1 RGCY 5 cut(s) 5, 85, 144, 282, 323
CviQI GTAC 1 cut(s) 261
DdeI CTNAG 1 cut(s) 209
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
Eam1104I CTCTTC 1 cut(s) 143
EarI CTCTTC 1 cut(s) 143
Eco24I GRGCYC 1 cut(s) 284
EcoT38I GRGCYC 1 cut(s) 284
FaeI CATG 5 cut(s) 49, 79, 130, 208, 271
FaiI YATR 6 cut(s) 47, 77, 128, 182, 206, 269
FatI CATG 5 cut(s) 45, 75, 126, 204, 267
FbaI TGATCA 1 cut(s) 129
FokI GGATG 1 cut(s) 239
FriOI GRGCYC 1 cut(s) 284
FspBI CTAG 1 cut(s) 340
GsaI CCCAGC 1 cut(s) 170
Hin1II CATG 5 cut(s) 49, 79, 130, 208, 271
HphI GGTGA 2 cut(s) 230, 242
Hpy188III TCNNGA 2 cut(s) 76, 139
HpyAV CCTTC 3 cut(s) 62, 73, 209
HpyCH4IV ACGT 1 cut(s) 299
HpyCH4V TGCA 5 cut(s) 90, 161, 175, 204, 295
HpyF10VI GCNNNNNNNGC 1 cut(s) 172
HpyF3I CTNAG 1 cut(s) 209
HpySE526I ACGT 1 cut(s) 299
Hsp92II CATG 5 cut(s) 49, 79, 130, 208, 271
Ksp22I TGATCA 1 cut(s) 129
Kzo9I GATC 1 cut(s) 129
LmnI GCTCC 3 cut(s) 62, 82, 116
LpnPI CCDG 4 cut(s) 54, 152, 161, 297
LweI GCATC 1 cut(s) 282
MaeI CTAG 1 cut(s) 340
MaeII ACGT 1 cut(s) 299
MalI GATC 1 cut(s) 131
MboI GATC 1 cut(s) 129
MboII GAAGA 2 cut(s) 41, 160
MhlI GDGCHC 1 cut(s) 284
MnlI CCTC 2 cut(s) 48, 310
MseI TTAA 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 172
NdeII GATC 1 cut(s) 129
NlaIII CATG 5 cut(s) 49, 79, 130, 208, 271
NspI RCATGY 1 cut(s) 208
PaeI GCATGC 1 cut(s) 208
PagI TCATGA 1 cut(s) 75
PspFI CCCAGC 1 cut(s) 166
RsaI GTAC 1 cut(s) 262
RsaNI GTAC 1 cut(s) 261
SaqAI TTAA 1 cut(s) 107
Sau3AI GATC 1 cut(s) 129
SduI GDGCHC 1 cut(s) 284
SetI ASST 8 cut(s) 13, 59, 87, 146, 220, 278, 302, 325
SfaNI GCATC 1 cut(s) 282
SphI GCATGC 1 cut(s) 208
SspMI CTAG 1 cut(s) 340
TaiI ACGT 1 cut(s) 302
TaqI TCGA 1 cut(s) 138
TatI WGTACW 1 cut(s) 260
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 64, 92
TspGWI ACGGA 1 cut(s) 129
XceI RCATGY 1 cut(s) 208
XspI CTAG 1 cut(s) 340
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.