Rmu_sc0000570.1_g000026

Calcium-binding protein PBP1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000570.1
OG0000967
Physical Location & Seq
Forward (+)
134591 .. 134944
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000570.1_g000026.1.cds

Sequence Viewer

Length: 354 bp
atggcgtgccaaaacggagtggtgtttgaagatttcttcccggccatggtcgacaagttgggagcggaaggcttcatgaaggagctctgcaacggctttcggcttttgatggacggagagagaggcgtgatcacgtttcagagcttgaagaggaactccggcttgttgggattgcaaggtatgagcgacgatgaggtgaggaacatgatcaaagaaggtgatttgaatggtgatgggtgcttgaatgagatggagttttgtacactcatgtttaggttgagtcctgctatgatggaaagttcagtggagttgttggaggaagcttttgttactgatgatggtgatcagatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EF-hand_8

Protein Analysis

117

Amino Acids

13.01

Weight (kDa)

4.12

Isoelectric Point (pI)

39.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 65
AccI GTMKAC 1 cut(s) 51
AciI CCGC 1 cut(s) 65
AcoI YGGCCR 1 cut(s) 42
AfaI GTAC 1 cut(s) 262
AfiI CCNNNNNNNGG 1 cut(s) 46
AgsI TTSAA 4 cut(s) 29, 148, 226, 244
AluBI AGCT 3 cut(s) 85, 144, 323
AluI AGCT 3 cut(s) 85, 144, 323
Alw21I GWGCWC 1 cut(s) 87
AoxI GGCC 1 cut(s) 42
AsuC2I CCSGG 1 cut(s) 41
AsuHPI GGTGA 4 cut(s) 208, 230, 242, 353
BanII GRGCYC 1 cut(s) 87
Bbv12I GWGCWC 1 cut(s) 87
BccI CCATC 5 cut(s) 103, 227, 244, 286, 332
BceAI ACGGC 1 cut(s) 109
BclI TGATCA 3 cut(s) 129, 207, 343
BcnI CCSGG 1 cut(s) 41
Bme1390I CCNGG 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 41
BpuMI CCSGG 1 cut(s) 41
BsaBI GATNNNNATC 1 cut(s) 342
BsaJI CCNNGG 1 cut(s) 45
Bsc4I CCNNNNNNNGG 1 cut(s) 46
Bse8I GATNNNNATC 1 cut(s) 342
BseDI CCNNGG 1 cut(s) 45
BseJI GATNNNNATC 1 cut(s) 342
BseLI CCNNNNNNNGG 1 cut(s) 46
BshFI GGCC 1 cut(s) 44
BsiHKAI GWGCWC 1 cut(s) 87
BsiSI CCGG 2 cut(s) 41, 159
BslI CCNNNNNNNGG 1 cut(s) 46
BsnI GGCC 1 cut(s) 44
Bsp1286I GDGCHC 1 cut(s) 87
Bsp1407I TGTACA 1 cut(s) 260
Bsp143I GATC 3 cut(s) 129, 207, 343
Bsp19I CCATGG 1 cut(s) 45
BspACI CCGC 1 cut(s) 65
BspANI GGCC 1 cut(s) 44
BspHI TCATGA 1 cut(s) 75
BsrBI CCGCTC 1 cut(s) 65
BsrGI TGTACA 1 cut(s) 260
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 3 cut(s) 129, 207, 343
BssT1I CCWWGG 1 cut(s) 45
Bst6I CTCTTC 1 cut(s) 143
BstAUI TGTACA 1 cut(s) 260
BstC8I GCNNGC 1 cut(s) 7
BstDSI CCRYGG 1 cut(s) 45
BstKTI GATC 3 cut(s) 132, 210, 346
BstMBI GATC 3 cut(s) 129, 207, 343
BstSCI CCNGG 1 cut(s) 39
BsuRI GGCC 1 cut(s) 44
BtgI CCRYGG 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 309
Cac8I GCNNGC 1 cut(s) 7
CciI TCATGA 1 cut(s) 75
Csp6I GTAC 1 cut(s) 261
CviAII CATG 4 cut(s) 46, 76, 205, 268
CviJI RGCY 8 cut(s) 44, 72, 85, 96, 103, 144, 162, 323
CviKI_1 RGCY 8 cut(s) 44, 72, 85, 96, 103, 144, 162, 323
CviQI GTAC 1 cut(s) 261
DpnI GATC 3 cut(s) 131, 209, 345
DpnII GATC 3 cut(s) 129, 207, 343
EaeI YGGCCR 1 cut(s) 42
Eam1104I CTCTTC 1 cut(s) 143
EarI CTCTTC 1 cut(s) 143
Ecl136II GAGCTC 1 cut(s) 85
Eco130I CCWWGG 1 cut(s) 45
Eco24I GRGCYC 1 cut(s) 87
Eco53kI GAGCTC 1 cut(s) 85
EcoICRI GAGCTC 1 cut(s) 85
EcoT14I CCWWGG 1 cut(s) 45
EcoT38I GRGCYC 1 cut(s) 87
ErhI CCWWGG 1 cut(s) 45
FaeI CATG 4 cut(s) 49, 79, 208, 271
FaiI YATR 6 cut(s) 47, 77, 182, 206, 269, 290
FatI CATG 4 cut(s) 45, 75, 204, 267
FbaI TGATCA 3 cut(s) 129, 207, 343
FblI GTMKAC 1 cut(s) 51
FriOI GRGCYC 1 cut(s) 87
HaeIII GGCC 1 cut(s) 44
HapII CCGG 2 cut(s) 41, 159
Hin1II CATG 4 cut(s) 49, 79, 208, 271
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HindIII AAGCTT 1 cut(s) 321
HinfI GANTC 1 cut(s) 280
HpaII CCGG 2 cut(s) 41, 159
HphI GGTGA 4 cut(s) 208, 230, 242, 353
Hpy166II GTNNAC 2 cut(s) 52, 263
Hpy188I TCNGA 2 cut(s) 141, 348
Hpy188III TCNNGA 1 cut(s) 76
Hpy8I GTNNAC 2 cut(s) 52, 263
Hpy99I CGWCG 1 cut(s) 191
HpyAV CCTTC 3 cut(s) 62, 73, 209
HpyCH4IV ACGT 1 cut(s) 134
HpyCH4V TGCA 2 cut(s) 90, 175
HpySE526I ACGT 1 cut(s) 134
Hsp92II CATG 4 cut(s) 49, 79, 208, 271
Ksp22I TGATCA 3 cut(s) 129, 207, 343
Kzo9I GATC 3 cut(s) 129, 207, 343
LmnI GCTCC 2 cut(s) 62, 82
LpnPI CCDG 3 cut(s) 54, 172, 297
MaeII ACGT 1 cut(s) 134
MaeIII GTNAC 1 cut(s) 328
MalI GATC 3 cut(s) 131, 209, 345
MbiI CCGCTC 1 cut(s) 65
MboI GATC 3 cut(s) 129, 207, 343
MboII GAAGA 3 cut(s) 28, 41, 160
MhlI GDGCHC 1 cut(s) 87
MlyI GAGTC 1 cut(s) 289
MmeI TCCRAC 1 cut(s) 294
MnlI CCTC 5 cut(s) 116, 144, 187, 192, 310
MspI CCGG 2 cut(s) 41, 159
MspR9I CCNGG 1 cut(s) 41
NciI CCSGG 1 cut(s) 41
NcoI CCATGG 1 cut(s) 45
NdeII GATC 3 cut(s) 129, 207, 343
NlaIII CATG 4 cut(s) 49, 79, 208, 271
PagI TCATGA 1 cut(s) 75
PleI GAGTC 1 cut(s) 288
PpsI GAGTC 1 cut(s) 288
Psp124BI GAGCTC 1 cut(s) 87
RsaI GTAC 1 cut(s) 262
RsaNI GTAC 1 cut(s) 261
SacI GAGCTC 1 cut(s) 87
SalI GTCGAC 1 cut(s) 50
Sau3AI GATC 3 cut(s) 129, 207, 343
SchI GAGTC 1 cut(s) 289
ScrFI CCNGG 1 cut(s) 41
SduI GDGCHC 1 cut(s) 87
SetI ASST 8 cut(s) 87, 137, 146, 181, 198, 220, 278, 325
SsiI CCGC 1 cut(s) 65
SstI GAGCTC 1 cut(s) 87
StyD4I CCNGG 1 cut(s) 39
StyI CCWWGG 1 cut(s) 45
TaiI ACGT 1 cut(s) 137
TaqI TCGA 1 cut(s) 51
TatI WGTACW 1 cut(s) 260
TscAI CASTG 1 cut(s) 309
TspDTI ATGAA 2 cut(s) 64, 92
TspGWI ACGGA 2 cut(s) 30, 129
TspRI CASTG 1 cut(s) 309
XmiI GTMKAC 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.