Prupe.4G191700_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Reverse (-)
11520656 .. 11520895
240 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G191700.1

Sequence Viewer

Length: 240 bp
ATGGGTGGTGAAATATGCAAGTTTGAGAAGGAATTGAAGTCCATGATGCAGCAGAAGATGAATGCTGCAGAGCCATCAGCTGCTGGTGGTGGTGGCGGCAATGGGGCCAAAACCAGGTGGAGCAATACTGCTGCTGCTGGGGGTGTGAGCCAGGAAAATAGGATGACCCTTGATGATGAGAGAAGAAGAAGAGACAAGGCTGAAAATTTGATTCAGCTAATCTGCTGGGGACCCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.56

Weight (kDa)

8.74

Isoelectric Point (pI)

58.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 96
AcsI RAATTY 1 cut(s) 205
AfiI CCNNNNNNNGG 1 cut(s) 114
AgsI TTSAA 1 cut(s) 37
AjnI CCWGG 2 cut(s) 113, 150
AluBI AGCT 2 cut(s) 80, 217
AluI AGCT 2 cut(s) 80, 217
Alw26I GTCTC 1 cut(s) 186
AlwNI CAGNNNCTG 1 cut(s) 83
AoxI GGCC 1 cut(s) 105
ApeKI GCWGC 5 cut(s) 49, 65, 80, 131, 134
ApoI RAATTY 1 cut(s) 205
AspS9I GGNCC 2 cut(s) 105, 230
AsuHPI GGTGA 1 cut(s) 20
AvaII GGWCC 1 cut(s) 230
BbvI GCAGC 5 cut(s) 52, 61, 67, 118, 121
BccI CCATC 1 cut(s) 82
BciT130I CCWGG 2 cut(s) 115, 152
BcoDI GTCTC 1 cut(s) 186
BfmI CTRYAG 1 cut(s) 66
BisI GCNGC 6 cut(s) 50, 66, 81, 97, 132, 135
BlsI GCNGC 6 cut(s) 51, 67, 82, 98, 133, 136
Bme1390I CCNGG 2 cut(s) 115, 152
Bme18I GGWCC 1 cut(s) 230
BmgT120I GGNCC 2 cut(s) 105, 230
BmiI GGNNCC 3 cut(s) 106, 231, 232
BmrFI CCNGG 2 cut(s) 115, 152
BmsI GCATC 1 cut(s) 36
Bsc4I CCNNNNNNNGG 1 cut(s) 114
Bse3DI GCAATG 1 cut(s) 106
BseBI CCWGG 2 cut(s) 115, 152
BseGI GGATG 1 cut(s) 168
BseLI CCNNNNNNNGG 1 cut(s) 114
BseMI GCAATG 1 cut(s) 106
BseXI GCAGC 5 cut(s) 52, 61, 67, 118, 121
BseYI CCCAGC 2 cut(s) 137, 225
BshFI GGCC 1 cut(s) 107
BslI CCNNNNNNNGG 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 186
BsmI GAATGC 1 cut(s) 67
BsnI GGCC 1 cut(s) 107
BspACI CCGC 1 cut(s) 96
BspANI GGCC 1 cut(s) 107
BspLI GGNNCC 3 cut(s) 106, 231, 232
BspMAI CTGCAG 1 cut(s) 70
BsrDI GCAATG 1 cut(s) 106
Bst2UI CCWGG 2 cut(s) 115, 152
Bst6I CTCTTC 1 cut(s) 184
BstF5I GGATG 1 cut(s) 168
BstMAI GTCTC 1 cut(s) 186
BstNI CCWGG 2 cut(s) 115, 152
BstSCI CCNGG 2 cut(s) 113, 150
BstSFI CTRYAG 1 cut(s) 66
BstV1I GCAGC 5 cut(s) 52, 61, 67, 118, 121
BsuRI GGCC 1 cut(s) 107
BtsCI GGATG 1 cut(s) 168
CaiI CAGNNNCTG 1 cut(s) 83
Cfr13I GGNCC 2 cut(s) 105, 230
CsiI ACCWGGT 1 cut(s) 113
CviAII CATG 1 cut(s) 43
CviJI RGCY 6 cut(s) 73, 80, 107, 150, 200, 217
CviKI_1 RGCY 6 cut(s) 73, 80, 107, 150, 200, 217
Eam1104I CTCTTC 1 cut(s) 184
EarI CTCTTC 1 cut(s) 184
Eco47I GGWCC 1 cut(s) 230
EcoO109I RGGNCCY 1 cut(s) 230
EcoRII CCWGG 2 cut(s) 113, 150
FaeI CATG 1 cut(s) 46
FaiI YATR 2 cut(s) 16, 44
FatI CATG 1 cut(s) 42
Fnu4HI GCNGC 6 cut(s) 50, 66, 81, 97, 132, 135
FokI GGATG 1 cut(s) 175
Fsp4HI GCNGC 6 cut(s) 50, 66, 81, 97, 132, 135
GluI GCNGC 6 cut(s) 50, 66, 81, 97, 132, 135
GsaI CCCAGC 2 cut(s) 141, 229
HaeIII GGCC 1 cut(s) 107
Hin1II CATG 1 cut(s) 46
HinfI GANTC 1 cut(s) 211
HphI GGTGA 1 cut(s) 20
HpyAV CCTTC 1 cut(s) 22
HpyCH4V TGCA 3 cut(s) 18, 49, 68
Hsp92II CATG 1 cut(s) 46
KflI GGGWCCC 1 cut(s) 230
LmnI GCTCC 1 cut(s) 120
LpnPI CCDG 7 cut(s) 69, 100, 123, 127, 137, 164, 211
Lsp1109I GCAGC 5 cut(s) 52, 61, 67, 118, 121
LweI GCATC 1 cut(s) 36
MabI ACCWGGT 1 cut(s) 113
MboII GAAGA 4 cut(s) 67, 195, 198, 201
MfeI CAATTG 1 cut(s) 235
MluCI AATT 3 cut(s) 32, 205, 235
MspA1I CMGCKG 1 cut(s) 80
MspR9I CCNGG 2 cut(s) 115, 152
MunI CAATTG 1 cut(s) 235
Mva1269I GAATGC 1 cut(s) 67
MvaI CCWGG 2 cut(s) 115, 152
NlaIII CATG 1 cut(s) 46
NlaIV GGNNCC 3 cut(s) 106, 231, 232
PctI GAATGC 1 cut(s) 67
PfeI GAWTC 1 cut(s) 211
PkrI GCNGC 6 cut(s) 51, 67, 82, 98, 133, 136
PpuMI RGGWCCY 1 cut(s) 230
Psp5II RGGWCCY 1 cut(s) 230
Psp6I CCWGG 2 cut(s) 113, 150
PspFI CCCAGC 2 cut(s) 137, 225
PspGI CCWGG 2 cut(s) 113, 150
PspN4I GGNNCC 3 cut(s) 106, 231, 232
PspPI GGNCC 2 cut(s) 105, 230
PspPPI RGGWCCY 1 cut(s) 230
PstI CTGCAG 1 cut(s) 70
PstNI CAGNNNCTG 1 cut(s) 83
PvuII CAGCTG 1 cut(s) 80
SatI GCNGC 6 cut(s) 50, 66, 81, 97, 132, 135
Sau96I GGNCC 2 cut(s) 105, 230
ScrFI CCNGG 2 cut(s) 115, 152
SetI ASST 3 cut(s) 82, 119, 219
SexAI ACCWGGT 1 cut(s) 113
SfaNI GCATC 1 cut(s) 36
SfcI CTRYAG 1 cut(s) 66
SinI GGWCC 1 cut(s) 230
Sse9I AATT 3 cut(s) 32, 205, 235
SsiI CCGC 1 cut(s) 96
StyD4I CCNGG 2 cut(s) 113, 150
TasI AATT 3 cut(s) 32, 205, 235
TauI GCSGC 1 cut(s) 99
TfiI GAWTC 1 cut(s) 211
TseI GCWGC 5 cut(s) 49, 65, 80, 131, 134
TspDTI ATGAA 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 230
XapI RAATTY 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.