Rh5DG463700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0003464
Physical Location & Seq
Reverse (-)
73483569 .. 73484755
1187 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG463700.1

Sequence Viewer

Length: 204 bp
ATGCCTTCATCCTCCATCCCTCCAGTAGTCCAATCTACTCCATCCCTCTTCCGCTGCTTTGGTAGATCTACGATTCTGCTACAATCCCAACGAGTCAACGACGCCGTCGTTCACCTCAAATTCGGAGGCTACCGTGGCCTCTTCTCTCAGATCAAGGTTCGAGTGCTATTCGGGGGCTTCCCCTTTTCTACAAGGATACCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.43

Weight (kDa)

11.72

Isoelectric Point (pI)

66.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 52
AcsI RAATTY 1 cut(s) 119
AcyI GRCGYC 1 cut(s) 102
AoxI GGCC 1 cut(s) 136
ApeKI GCWGC 1 cut(s) 54
ApoI RAATTY 1 cut(s) 119
AsuHPI GGTGA 1 cut(s) 104
BbvI GCAGC 1 cut(s) 41
BccI CCATC 2 cut(s) 23, 49
BceAI ACGGC 1 cut(s) 89
BciVI GTATCC 1 cut(s) 189
BfuI GTATCC 1 cut(s) 189
BglII AGATCT 1 cut(s) 65
BisI GCNGC 1 cut(s) 55
BlsI GCNGC 1 cut(s) 56
BpmI CTGGAG 1 cut(s) 6
BsaHI GRCGYC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 133
Bse1I ACTGG 1 cut(s) 23
BseDI CCNNGG 1 cut(s) 133
BseGI GGATG 3 cut(s) 8, 15, 41
BseMII CTCAG 1 cut(s) 161
BseNI ACTGG 1 cut(s) 23
BseXI GCAGC 1 cut(s) 41
BshFI GGCC 1 cut(s) 138
BsnI GGCC 1 cut(s) 138
Bsp143I GATC 2 cut(s) 65, 150
BspACI CCGC 1 cut(s) 52
BspANI GGCC 1 cut(s) 138
BspCNI CTCAG 1 cut(s) 160
BsrI ACTGG 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 133
BssMI GATC 2 cut(s) 65, 150
BssNI GRCGYC 1 cut(s) 102
Bst4CI ACNGT 1 cut(s) 134
Bst6I CTCTTC 2 cut(s) 53, 146
BstACI GRCGYC 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 147
BstDSI CCRYGG 1 cut(s) 133
BstF5I GGATG 3 cut(s) 8, 15, 41
BstKTI GATC 2 cut(s) 68, 153
BstMBI GATC 2 cut(s) 65, 150
BstMWI GCNNNNNNNGC 1 cut(s) 135
BstV1I GCAGC 1 cut(s) 41
BstX2I RGATCY 1 cut(s) 65
BstYI RGATCY 1 cut(s) 65
BsuI GTATCC 1 cut(s) 189
BsuRI GGCC 1 cut(s) 138
BtgI CCRYGG 1 cut(s) 133
BtsCI GGATG 3 cut(s) 8, 15, 41
CseI GACGC 1 cut(s) 110
CviJI RGCY 3 cut(s) 129, 138, 177
CviKI_1 RGCY 3 cut(s) 129, 138, 177
DdeI CTNAG 1 cut(s) 147
DpnI GATC 2 cut(s) 67, 152
DpnII GATC 2 cut(s) 65, 150
Eam1104I CTCTTC 2 cut(s) 53, 146
EarI CTCTTC 2 cut(s) 53, 146
Fnu4HI GCNGC 1 cut(s) 55
FokI GGATG 2 cut(s) 2, 28
Fsp4HI GCNGC 1 cut(s) 55
GluI GCNGC 1 cut(s) 55
GsuI CTGGAG 1 cut(s) 6
HaeIII GGCC 1 cut(s) 138
HgaI GACGC 1 cut(s) 110
Hin1I GRCGYC 1 cut(s) 102
HincII GTYRAC 1 cut(s) 97
HindII GTYRAC 1 cut(s) 97
HinfI GANTC 2 cut(s) 73, 93
HphI GGTGA 1 cut(s) 104
Hpy166II GTNNAC 2 cut(s) 97, 112
Hpy188I TCNGA 2 cut(s) 125, 150
Hpy8I GTNNAC 2 cut(s) 97, 112
Hpy99I CGWCG 2 cut(s) 104, 110
HpyAV CCTTC 1 cut(s) 15
HpyCH4III ACNGT 1 cut(s) 134
HpyF10VI GCNNNNNNNGC 1 cut(s) 135
HpyF3I CTNAG 1 cut(s) 147
Hsp92I GRCGYC 1 cut(s) 102
Kzo9I GATC 2 cut(s) 65, 150
LpnPI CCDG 1 cut(s) 36
Lsp1109I GCAGC 1 cut(s) 41
MalI GATC 2 cut(s) 67, 152
MboI GATC 2 cut(s) 65, 150
MboII GAAGA 2 cut(s) 40, 133
MflI RGATCY 1 cut(s) 65
MluCI AATT 1 cut(s) 119
MlyI GAGTC 1 cut(s) 102
MnlI CCTC 6 cut(s) 22, 30, 56, 119, 125, 149
MspA1I CMGCKG 1 cut(s) 54
MwoI GCNNNNNNNGC 1 cut(s) 135
NdeII GATC 2 cut(s) 65, 150
PcsI WCGNNNNNNNCGW 1 cut(s) 105
PfeI GAWTC 1 cut(s) 73
PflFI GACNNNGTC 1 cut(s) 104
PkrI GCNGC 1 cut(s) 56
PleI GAGTC 1 cut(s) 101
PpsI GAGTC 1 cut(s) 101
PsuI RGATCY 1 cut(s) 65
PsyI GACNNNGTC 1 cut(s) 104
SatI GCNGC 1 cut(s) 55
Sau3AI GATC 2 cut(s) 65, 150
SchI GAGTC 1 cut(s) 102
SetI ASST 2 cut(s) 117, 159
SgeI CNNG 6 cut(s) 35, 104, 146, 166, 173, 184
Sse9I AATT 1 cut(s) 119
SsiI CCGC 1 cut(s) 52
TaaI ACNGT 1 cut(s) 134
TaqI TCGA 1 cut(s) 160
TasI AATT 1 cut(s) 119
TfiI GAWTC 1 cut(s) 73
TseI GCWGC 1 cut(s) 54
Tth111I GACNNNGTC 1 cut(s) 104
XapI RAATTY 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.